ID: 1061774461

View in Genome Browser
Species Human (GRCh38)
Location 9:132951646-132951668
Sequence GATCTGAAACCTGTGAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061774461_1061774466 28 Left 1061774461 9:132951646-132951668 CCTCTCCTCACAGGTTTCAGATC 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1061774466 9:132951697-132951719 GTCCAGCTCCTCCTCTGTGTGGG No data
1061774461_1061774463 -6 Left 1061774461 9:132951646-132951668 CCTCTCCTCACAGGTTTCAGATC 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1061774463 9:132951663-132951685 CAGATCCATATCATAGCTGAAGG No data
1061774461_1061774465 27 Left 1061774461 9:132951646-132951668 CCTCTCCTCACAGGTTTCAGATC 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061774461 Original CRISPR GATCTGAAACCTGTGAGGAG AGG (reversed) Intronic
902710565 1:18236714-18236736 GATGTGAAGACGGTGAGGAGTGG + Intronic
902783745 1:18720216-18720238 CATCTGAGAGCTGGGAGGAGGGG - Intronic
904424062 1:30412359-30412381 GAGCCAAGACCTGTGAGGAGAGG + Intergenic
906789932 1:48650230-48650252 GGTCTGTGGCCTGTGAGGAGCGG - Intronic
906977286 1:50589189-50589211 GGTTTGAAGCCTGTGATGAGTGG + Intronic
911678281 1:100684005-100684027 AATCTGAAACATGGGATGAGGGG + Intergenic
912458571 1:109816346-109816368 GTTCTGGCACTTGTGAGGAGGGG + Intergenic
913129664 1:115828352-115828374 GGTCTGCACCCTGAGAGGAGGGG + Intergenic
913498091 1:119446725-119446747 CATCAGAAACCTATGAGGTGGGG + Intergenic
917066539 1:171100800-171100822 GATGTGATATCTTTGAGGAGGGG - Intronic
917368473 1:174260497-174260519 TATATGAAATGTGTGAGGAGTGG + Intronic
917840100 1:178970478-178970500 GGCCTGAAAGCTGGGAGGAGAGG + Intergenic
920570631 1:207014358-207014380 GATCTCTATCCTGTGAGCAGTGG - Intronic
923137357 1:231130203-231130225 AATCAGAATCCTGTGCGGAGGGG + Intergenic
1064863316 10:19851409-19851431 GTACTAAAACATGTGAGGAGGGG - Intronic
1066509033 10:36074811-36074833 GAACTGAAGCCTGTGGTGAGAGG + Intergenic
1067998925 10:51308876-51308898 GAGCTGAGACCTTTGAGGAGGGG + Intronic
1068529959 10:58174621-58174643 TATCTAAATACTGTGAGGAGTGG - Intergenic
1068703583 10:60047542-60047564 AATCTGAAGCTTGTGAAGAGTGG + Intronic
1068859421 10:61831397-61831419 AATTTCAAACCTGTGAGTAGAGG + Intergenic
1069651048 10:70049131-70049153 GATCTTAATCATGTGTGGAGGGG - Intergenic
1073015043 10:100391895-100391917 GAGCTGAAAATGGTGAGGAGAGG - Intergenic
1073044516 10:100628889-100628911 GGTCTGCAACCTGGGAGGACAGG - Intergenic
1073513147 10:104055021-104055043 GATATGAAAACTGTGAGATGGGG + Intronic
1073755451 10:106576259-106576281 GCTCAGAAACTTGTGAGTAGTGG + Exonic
1077114078 11:875214-875236 CAACTGAAACCTGTGAAGATAGG - Intronic
1077862521 11:6195767-6195789 GATCTGACACCTGTGATCTGGGG - Intergenic
1078679642 11:13463432-13463454 GAGCTGATGTCTGTGAGGAGAGG - Intergenic
1079288061 11:19157937-19157959 AACCTGACACCTGTCAGGAGTGG + Intronic
1084889379 11:72229148-72229170 GACCTGGAAGCTGTGAGGGGTGG + Exonic
1086591050 11:88514105-88514127 GATCTGCCACATCTGAGGAGGGG + Intronic
1086826307 11:91503577-91503599 TATCTGAGACCTGGGAGAAGAGG + Intergenic
1086917812 11:92551103-92551125 GATCTGATCCCTGTGAGGCAGGG + Intronic
1087655864 11:100922229-100922251 GATCCGAGCCCTGTGAGGAAGGG - Intronic
1088153334 11:106774912-106774934 GAGCTGAAAACTGTGAGAAAGGG - Intronic
1089417673 11:118306115-118306137 GATGTGACTCCTGTAAGGAGTGG + Intronic
1091034950 11:132224550-132224572 AAGCTGAAATCTGTGAGGTGAGG - Intronic
1099930818 12:89072293-89072315 TATCTCACACCTGTAAGGAGAGG - Intergenic
1101795748 12:107971857-107971879 GATCTGAAAACTTTGTGAAGTGG + Intergenic
1105577521 13:21667970-21667992 GAGCTGGGACCCGTGAGGAGAGG + Intergenic
1110830415 13:80024759-80024781 CCTCTGAAACATGAGAGGAGGGG + Intergenic
1112557004 13:100478238-100478260 GTTTTGAATCCTCTGAGGAGCGG + Intronic
1112665630 13:101569543-101569565 AGTCTGAATCCTGTAAGGAGAGG - Intronic
1112750520 13:102578845-102578867 GAACTGCACCCTGTGAGGATGGG + Intergenic
1113892984 13:113746177-113746199 AAGCTGAGCCCTGTGAGGAGAGG + Intergenic
1116236704 14:42287537-42287559 GCTCTGATAGCTGTGAGGTGAGG - Intergenic
1117617371 14:57547266-57547288 GATCTTAAAACTCTGAGAAGGGG - Intergenic
1119057496 14:71438064-71438086 GATGTGAAACCTTTTAGAAGTGG + Intronic
1119995007 14:79243909-79243931 GATCTGGAGCCTGAGAGCAGGGG - Intronic
1121515245 14:94545305-94545327 GATCTGACCCCTGTGGGGAGGGG + Intergenic
1123471324 15:20555801-20555823 GATATTAAACCTCTAAGGAGTGG + Intergenic
1123646679 15:22444567-22444589 GATATTAAACCTCTAAGGAGTGG - Intergenic
1123731625 15:23150796-23150818 GATATTAAACCTCTAAGGAGTGG + Intergenic
1123749763 15:23348179-23348201 GATATTAAACCTCTAAGGAGTGG + Intergenic
1124282133 15:28372074-28372096 GATATTAAACCTCTAAGGAGTGG + Intergenic
1124300568 15:28539544-28539566 GATATTAAACCTCTAAGGAGTGG - Intergenic
1126356049 15:47797099-47797121 GATCTGAAACTTGAAAGGAATGG + Intergenic
1129287616 15:74538905-74538927 GAGCTTGAACCTGAGAGGAGAGG - Intergenic
1129696201 15:77741887-77741909 CAGCTGAAACCAGAGAGGAGAGG + Intronic
1129759935 15:78123509-78123531 GATCTGGGCCCTGGGAGGAGTGG + Intronic
1133041136 16:3060149-3060171 GATCCTAAAACTGTGGGGAGTGG - Exonic
1133595916 16:7291727-7291749 GAGATGCAGCCTGTGAGGAGAGG + Intronic
1136360441 16:29775969-29775991 GATGGTAAACCTGTGAGGGGTGG + Intergenic
1136687715 16:32004829-32004851 TTTCTGAAGCCTTTGAGGAGAGG + Intergenic
1136788323 16:32948380-32948402 TTTCTGAAGCCTTTGAGGAGAGG + Intergenic
1136881493 16:33905551-33905573 TTTCTGAAGCCTTTGAGGAGAGG - Intergenic
1139367671 16:66443584-66443606 GACCAGAGAACTGTGAGGAGGGG - Intronic
1141175424 16:81715474-81715496 CACCTGACACCTGTGAGGTGTGG + Intergenic
1203090521 16_KI270728v1_random:1209895-1209917 TTTCTGAAGCCTTTGAGGAGAGG + Intergenic
1147148701 17:38500499-38500521 TTTCTGAAGCCTTTGAGGAGAGG + Intronic
1148322745 17:46767337-46767359 GATCTGAAGCTTGGGTGGAGTGG - Intronic
1148806211 17:50265303-50265325 GAGCTGAGCCCTGTGTGGAGAGG + Intergenic
1150226736 17:63528475-63528497 GCTCTGATGGCTGTGAGGAGGGG + Intronic
1151231790 17:72690252-72690274 GATCTGACAGCTGGGAAGAGGGG + Intronic
1151601404 17:75108456-75108478 GACCTGAAACCTCAGAGGTGAGG + Intergenic
1151930984 17:77231165-77231187 GATCTAAAACCTGTCTGTAGTGG + Intergenic
1153232673 18:2954933-2954955 TATCTGAACCGTGTGAGGTGAGG - Intronic
1153570720 18:6470909-6470931 AATCAGCAATCTGTGAGGAGTGG - Intergenic
1155762327 18:29583815-29583837 GATCTTGTACATGTGAGGAGTGG - Intergenic
1156459944 18:37316013-37316035 GGACTGAGACCTGGGAGGAGAGG + Intronic
1157075096 18:44457123-44457145 GATGGGAAACATGTGAGGAGGGG - Intergenic
1157175436 18:45447356-45447378 GATGTGAAGCCAGAGAGGAGAGG + Intronic
1159129917 18:64269683-64269705 CAACTGAAATCTGTGTGGAGTGG - Intergenic
1161305667 19:3566214-3566236 GATCTCAGGCCTCTGAGGAGGGG - Intronic
1161990469 19:7681491-7681513 GTTCTGAAGGCTGGGAGGAGGGG - Intronic
1162120237 19:8461138-8461160 GTTCTGAAACATTTCAGGAGAGG + Intronic
1162890823 19:13731938-13731960 GATCTCAAACCTTTGAGGGAGGG - Exonic
1163530030 19:17843482-17843504 GAAGTAAAAGCTGTGAGGAGAGG + Exonic
1164957105 19:32395738-32395760 GATGAGAAACCTGTGAGAGGAGG + Intergenic
1165661697 19:37586470-37586492 TATCTGAAAACTGTTTGGAGAGG + Intronic
1166255246 19:41599751-41599773 GATGTGCACTCTGTGAGGAGGGG - Intronic
1167109208 19:47448947-47448969 GCTGTGAACCCTGTGAGGACAGG - Intronic
1168228220 19:55011612-55011634 GATCTGACACCTCTGAAGCGTGG + Intergenic
925985536 2:9212101-9212123 GACCTGGAACCCGTGAGGAGTGG - Intronic
926123445 2:10257028-10257050 GAACTGGTCCCTGTGAGGAGAGG - Intergenic
927328790 2:21837936-21837958 TATCTGAAAACTTTAAGGAGAGG - Intergenic
927657217 2:24959400-24959422 GGTCTGGAACCTCAGAGGAGAGG - Intronic
928613511 2:33014091-33014113 TATTTGAAACCTGTGAGGGATGG - Intronic
930569557 2:53067680-53067702 AATCTGAAACTTGTGAAGAGAGG + Intergenic
931633050 2:64318400-64318422 GATCTGAAATCTCTTAGGGGAGG + Intergenic
936438897 2:112533207-112533229 TATGTGAAACCTGTTTGGAGTGG - Exonic
937657014 2:124388022-124388044 ACTCTGAAGCCTATGAGGAGAGG - Intronic
942813644 2:180025484-180025506 CATCTAAAACCTGCAAGGAGAGG - Intergenic
949000370 2:241609939-241609961 GAGCTGAACCCTGTGGGAAGCGG + Intronic
1169648914 20:7845250-7845272 GATCTGAGATGTGAGAGGAGAGG - Intergenic
1170761284 20:19253647-19253669 TATGGGAAACCTGTGAGGATGGG - Intronic
1173223744 20:41149595-41149617 GATCTGAAGCTTAAGAGGAGAGG + Intronic
1173319571 20:41975281-41975303 GATCTGGACCCTGTGAGGACTGG - Intergenic
1173565710 20:44036916-44036938 GTTCTGAAATCTGAGAGGAGAGG - Intronic
1174658292 20:52190421-52190443 CATCTGAAAAATGGGAGGAGAGG + Intronic
1175243244 20:57565151-57565173 GATCTGAAACCACAGAGAAGTGG + Intronic
1175700881 20:61136264-61136286 GATCTAGACCCTGTGAGGAGGGG - Intergenic
1179091443 21:38269736-38269758 TCTCTGAAACCAGAGAGGAGGGG + Intronic
1181419130 22:22785756-22785778 GAAAAGAAACCTGGGAGGAGGGG - Intronic
1182119624 22:27778469-27778491 CATCGGGAACCTGTGAGGGGAGG - Intronic
1183299225 22:37050739-37050761 GGACTGAAACCAGTAAGGAGAGG + Intergenic
1184726118 22:46347643-46347665 GATGTGAAACGTGTGAGGCCGGG - Intronic
950268584 3:11594479-11594501 GATGTGTCACCTGTGAGGAAGGG - Intronic
951067354 3:18282550-18282572 GAGCTGGAACCAGGGAGGAGAGG + Intronic
951281621 3:20757317-20757339 GATCAGAAACCTTGGAGGTGGGG - Intergenic
953846919 3:46434924-46434946 CCTCTGAAACCTGTCAGGAAAGG - Intergenic
956693343 3:71898084-71898106 AAACTGAAATCTGTGAGGATGGG + Intergenic
960846778 3:122011335-122011357 AATCTGACACCCTTGAGGAGGGG + Intronic
961318805 3:126058349-126058371 GATCTGAAAGCTCAGAGGAGAGG - Intronic
961650168 3:128413234-128413256 GAGGTGAAACTTGAGAGGAGAGG + Intergenic
963203105 3:142604398-142604420 GATCTTAAACCTGGGGAGAGGGG - Intronic
967364711 3:188672831-188672853 GGTCTAAACCCTGGGAGGAGAGG + Intronic
967616299 3:191571571-191571593 GAGCTGAAACCTGAAAGGTGAGG - Intergenic
969877267 4:10145063-10145085 GATTTAAAACCTGTGAAAAGGGG + Intergenic
971367576 4:25989800-25989822 GATCTGAAACAGTCGAGGAGGGG + Intergenic
975063358 4:70032881-70032903 GATTTAAAACCTGTTTGGAGAGG + Intronic
977281789 4:95049031-95049053 GAGATTAAACATGTGAGGAGAGG - Intronic
979867428 4:125774224-125774246 GACCCGAAACCTAGGAGGAGGGG + Intergenic
983858959 4:172680452-172680474 AATCTGAAAGCTGTGATGAAGGG + Intronic
984881045 4:184410177-184410199 GAGCTGCAACCAGTGAGGAGTGG - Intronic
985140266 4:186832432-186832454 GCTGCGAACCCTGTGAGGAGAGG + Intergenic
992534675 5:77687613-77687635 GGAATGAAACTTGTGAGGAGGGG - Intergenic
995077990 5:108010445-108010467 GCTTTAAAACCTGTGTGGAGGGG + Intronic
996215463 5:120860154-120860176 GATCACAAATCTGTGAGGAATGG + Intergenic
997570732 5:134925288-134925310 GAGTAGAAACCTGTGAGGAAGGG + Intronic
997707411 5:135970100-135970122 GATGTGAAACCTGTGGATAGAGG - Intergenic
997855001 5:137365155-137365177 GAACTGCAGCCTGGGAGGAGAGG - Intronic
1000994931 5:167949227-167949249 GAGCTGAATGCTGTGAGGGGTGG - Intronic
1001079958 5:168660462-168660484 GGTCCCAAACCTGGGAGGAGGGG + Intergenic
1005490533 6:26343474-26343496 GATCTGAAATTTGTTTGGAGGGG - Intergenic
1006593824 6:35178185-35178207 GAGCTGAGAACTATGAGGAGAGG + Intergenic
1007073019 6:39049942-39049964 GAACTGAGATCTGTGGGGAGTGG + Intronic
1008018594 6:46549797-46549819 TTTCTGAGACCTGTGAGGACAGG - Exonic
1012318986 6:97818777-97818799 AATCTGAAAACTTTGAGGAAAGG - Intergenic
1013578639 6:111510299-111510321 GATTTGAAACCTCTTATGAGGGG + Intergenic
1014766829 6:125416679-125416701 GTTCTTAAAGCTGTGAGGATAGG + Intergenic
1017393765 6:153972475-153972497 GATCAGAAAGCGGTGAGGTGAGG + Intergenic
1017653238 6:156601898-156601920 CAACTGAAACCTGCGAGGATCGG - Intergenic
1019196151 6:170284319-170284341 CATCTGAAACCTGGGTCGAGTGG - Intronic
1019477990 7:1253126-1253148 GCTCTGAAACCAGGGAGGAGGGG - Intergenic
1021866554 7:24963754-24963776 TATCTTTAACATGTGAGGAGTGG + Intronic
1022264342 7:28739371-28739393 GATCTGAAAGGTGAGAGGGGAGG + Intronic
1025791556 7:64692327-64692349 TATCTGAAATGTGTGAGTAGTGG + Intronic
1025804355 7:64816016-64816038 TATCTGAAATGTGTGAGTAGTGG + Intronic
1026798479 7:73381231-73381253 AATCTGAAACATGTGAGCACTGG - Intergenic
1026876486 7:73881958-73881980 GAGCAGAAACCTCAGAGGAGGGG - Intergenic
1027459929 7:78439514-78439536 GATGTGGGACCTTTGAGGAGGGG + Intronic
1029113491 7:98224871-98224893 AGTCGGAAACCTGGGAGGAGTGG + Exonic
1031085013 7:117293897-117293919 AATCTGAGACCTGTAAGAAGGGG - Intronic
1033005536 7:137557852-137557874 GAGCTGGAACCTGGGAGAAGTGG - Intronic
1033158480 7:138976436-138976458 TATCCGAAACCTTGGAGGAGGGG - Intronic
1039117020 8:34102235-34102257 GATTTGACACCTGTGAGAACAGG + Intergenic
1039168544 8:34714595-34714617 AATATGAGAGCTGTGAGGAGGGG - Intergenic
1039250530 8:35659334-35659356 GATCTCAAACCTAAGAGAAGAGG - Intronic
1041871973 8:62645176-62645198 GATCTGAATCCATTGAAGAGTGG - Intronic
1043404222 8:79914445-79914467 GATCTGACACCTGTAAAGGGAGG - Intergenic
1045834564 8:106505271-106505293 GGTGTGAAGCCTATGAGGAGGGG + Intronic
1046019330 8:108645535-108645557 GATCAGAAATCTGTGATCAGAGG + Intronic
1046028153 8:108749992-108750014 GATCAGAGTCCTGTGAGGTGTGG - Intronic
1048137000 8:131756302-131756324 GATCAGGAAGATGTGAGGAGTGG - Intergenic
1048582966 8:135745637-135745659 GATCTGACCCCTGTGAGAAGAGG + Intergenic
1051748830 9:20320689-20320711 GAACTAGAAACTGTGAGGAGTGG - Intergenic
1056731384 9:89169278-89169300 GCACTGAGAGCTGTGAGGAGGGG - Intronic
1056800501 9:89687477-89687499 CTCCTGAAACCTGTCAGGAGGGG + Intergenic
1057784080 9:98073616-98073638 GATCCAAAACCTGAGGGGAGAGG + Intronic
1061774461 9:132951646-132951668 GATCTGAAACCTGTGAGGAGAGG - Intronic
1202630606 M:13486-13508 GAGTAGAAACCTGTGAGGAAAGG - Intergenic
1187371195 X:18707815-18707837 GATCTGACACATGTGAGTACTGG + Exonic
1191844274 X:65534746-65534768 GAGCTGAAGGCTGTGCGGAGCGG - Exonic
1192507627 X:71698580-71698602 CAACTGAGACATGTGAGGAGTGG - Intergenic
1192519069 X:71782972-71782994 CAACTGAGACATGTGAGGAGTGG + Intergenic
1195523417 X:105857414-105857436 GATCAGAAACCAATCAGGAGAGG + Intronic