ID: 1061774462

View in Genome Browser
Species Human (GRCh38)
Location 9:132951651-132951673
Sequence ATATGGATCTGAAACCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061774462_1061774466 23 Left 1061774462 9:132951651-132951673 CCTCACAGGTTTCAGATCCATAT 0: 1
1: 0
2: 1
3: 1
4: 121
Right 1061774466 9:132951697-132951719 GTCCAGCTCCTCCTCTGTGTGGG No data
1061774462_1061774465 22 Left 1061774462 9:132951651-132951673 CCTCACAGGTTTCAGATCCATAT 0: 1
1: 0
2: 1
3: 1
4: 121
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061774462 Original CRISPR ATATGGATCTGAAACCTGTG AGG (reversed) Intronic
905084712 1:35362374-35362396 ATAGAGATCTTAAAACTGTGAGG + Intronic
907358163 1:53893373-53893395 ATATGGATCTCAAACCTCCCAGG - Intronic
911114232 1:94228150-94228172 ATATGTATCTTAACCCTGTTGGG + Intronic
920153953 1:203933231-203933253 AAATGGATTTGAAACCTATTTGG + Intergenic
921144874 1:212344451-212344473 ACATGCATCTGAAACCAGAGTGG - Intronic
924279101 1:242418164-242418186 ACTTGGATCTGAAATCTGAGAGG + Intronic
1063771538 10:9208573-9208595 ATATGGATGGGAAACATGAGTGG - Intergenic
1068245549 10:54361177-54361199 TCATGGATGTGAAACCTCTGTGG - Intronic
1072608624 10:97002615-97002637 ATATGGGTTGGAAAACTGTGAGG + Intronic
1073034572 10:100554511-100554533 ATATGGACCAGACACCTGGGAGG + Exonic
1076559812 10:131354492-131354514 ATATGGCTCTGCAACTTGGGTGG + Intergenic
1080371574 11:31652030-31652052 AAATGGAACAGAAATCTGTGTGG - Intronic
1087223908 11:95576769-95576791 ACATGGATCTGAAACCAAAGTGG - Intergenic
1087829384 11:102802511-102802533 AGATGGATTTGAAATATGTGAGG + Intergenic
1089939100 11:122396917-122396939 ATAAGGATCTGATATCTTTGGGG + Intergenic
1090669508 11:128936635-128936657 TAAGGGATCTGAAACCTGAGAGG + Exonic
1093676173 12:21942387-21942409 ATATGGGGCCGAAACCTGGGAGG + Intergenic
1095374840 12:41514545-41514567 ATATGGATCTTAAGGCTCTGAGG + Intronic
1095481437 12:42640214-42640236 ATTTGGATCTTAATCCTTTGAGG + Intergenic
1095692274 12:45103704-45103726 GTAGTTATCTGAAACCTGTGAGG - Intergenic
1098037553 12:66320893-66320915 ATATTGATCTGCAAGATGTGGGG + Intronic
1098649624 12:72948089-72948111 AGAATAATCTGAAACCTGTGAGG - Intergenic
1098803279 12:74988415-74988437 ATATTGATCTGAATTCTGGGAGG + Intergenic
1099129313 12:78806462-78806484 ATATGGTTATGCAATCTGTGTGG - Intergenic
1100890353 12:99119025-99119047 ATTAGGATCTGATACCTTTGGGG - Intronic
1103463295 12:121122228-121122250 ATATGGCTATGAAACGTGAGAGG - Intergenic
1104149840 12:126071687-126071709 AGGTGGATCTGAAATCTATGGGG - Intergenic
1105719222 13:23097546-23097568 ATATGGTTCTAAAAACTGGGGGG - Intergenic
1113338042 13:109395523-109395545 ATATGGAGGTGGAGCCTGTGGGG + Intergenic
1126116248 15:45210362-45210384 ACATGGATCTCAACCCCGTGAGG - Intergenic
1126378854 15:48025253-48025275 ATATAGAAATGAAACCTTTGTGG - Intergenic
1129310123 15:74701577-74701599 ATAAGCATCTGAATTCTGTGAGG - Intergenic
1132716752 16:1294207-1294229 AAATGAAGCTGAGACCTGTGGGG - Intergenic
1132888390 16:2192619-2192641 GTAAGGATCTGAAAAATGTGAGG - Intronic
1134807457 16:17138087-17138109 TTAGGGATATGAAAACTGTGAGG - Intronic
1139200515 16:64971816-64971838 CTATGGCTCTGAAACCTTTTTGG + Intronic
1139203815 16:65005950-65005972 CTGTGGCTCAGAAACCTGTGAGG - Intronic
1148022577 17:44563062-44563084 AAATGGATCTTAAACTTCTGGGG + Intergenic
1148161680 17:45453803-45453825 ATCTGGCTCTGGAACCTGGGCGG + Exonic
1152747813 17:82049316-82049338 ATAGGGATCTGAAACCTCCAGGG + Intronic
1154314273 18:13291896-13291918 ATATGGCCCTGAAATCTGTTGGG + Intronic
1155355974 18:24954495-24954517 AGAGGGATCTGAAAACTGTCAGG + Intergenic
1157922103 18:51723835-51723857 TTATGGATCTGAAAAATGAGGGG - Intergenic
1158567610 18:58568427-58568449 ATATGGAGCTAAATCCTGGGGGG - Intronic
1159030974 18:63231592-63231614 ATAGAGATCTTACACCTGTGAGG + Intronic
1161369646 19:3903500-3903522 ATATGGAAAATAAACCTGTGAGG + Intronic
926300475 2:11598510-11598532 TTATGCAGCTGTAACCTGTGTGG + Intronic
927343336 2:22007794-22007816 ACATGGATCTGGAGCCAGTGAGG + Intergenic
927870971 2:26623570-26623592 AGATGGAGCTGAAACCTTAGGGG + Intronic
928613513 2:33014096-33014118 AAATCTATTTGAAACCTGTGAGG - Intronic
930028927 2:47046566-47046588 CTATGGATGTGAAAGCTCTGTGG - Intronic
931116031 2:59167777-59167799 ATTTGGATCTGGAACCTGTGAGG + Intergenic
934484544 2:94691578-94691600 ATGGGAATTTGAAACCTGTGTGG + Intergenic
935431568 2:102981516-102981538 ATTTGGATCAGACAACTGTGTGG - Intergenic
939021341 2:136961531-136961553 ATATAAATCGTAAACCTGTGAGG + Intronic
940262472 2:151795857-151795879 TTATGTATTTGAAATCTGTGTGG - Intronic
941316215 2:163995990-163996012 GTATGGATCTGAAACCAGAATGG - Intergenic
943454156 2:188082146-188082168 ATATGGGTCTGCAACCTCTTAGG - Intergenic
943611289 2:190038039-190038061 ATCTCAATATGAAACCTGTGAGG - Intronic
948508784 2:238449124-238449146 ATATGAATCTGAAAACAGGGTGG + Exonic
1172264269 20:33597446-33597468 GTATGGATCTGTGACCTGTTAGG + Intronic
1172853605 20:37984211-37984233 CTGTGGATCTGATCCCTGTGGGG - Intronic
1173004951 20:39133117-39133139 ATCAGGAGCTGGAACCTGTGAGG - Intergenic
1174724414 20:52846170-52846192 ATAAAAATCTGAAACCTGAGAGG + Intergenic
1175399167 20:58690980-58691002 AGCAGGCTCTGAAACCTGTGTGG - Intronic
1177986551 21:27982468-27982490 ATATGGCTTTGAAAACTCTGTGG - Intergenic
1178940799 21:36903441-36903463 ATATGTATCTCTAGCCTGTGTGG - Intronic
1179658373 21:42859708-42859730 ATACGGCTCACAAACCTGTGAGG + Exonic
1183304231 22:37073631-37073653 ATGTGGCTCTGCAAACTGTGTGG + Exonic
949752665 3:7372671-7372693 GTATCGATCTGATACCTGTTTGG - Intronic
951727868 3:25780505-25780527 GTAGAGATCTGAAAGCTGTGAGG - Intronic
953467303 3:43133774-43133796 AGATGGATCTGAAGCCACTGTGG + Intergenic
953880171 3:46687304-46687326 ATATTGCTCTTAAACCTGTGAGG - Intronic
965871871 3:173274782-173274804 ATCTGGTGCTGAAACCTGGGAGG + Intergenic
968866518 4:3216264-3216286 ATTTGTATCTCAAACCTCTGTGG + Intronic
969329630 4:6466395-6466417 TCATGGATATGCAACCTGTGTGG - Intronic
971008246 4:22399707-22399729 CTATGGAAATGAAACCAGTGTGG - Intronic
973148969 4:46864283-46864305 GTTTGTATCTGAAACCTGGGGGG - Intronic
975850080 4:78563289-78563311 ATGAGGATGAGAAACCTGTGAGG - Intronic
976380174 4:84389996-84390018 ATATCTATCTGAAACTTCTGGGG + Intergenic
977024297 4:91796491-91796513 AAATGAATTTGAAACCTGTCTGG - Intergenic
980168284 4:129254400-129254422 AGAGGGAGCTGAAACATGTGAGG + Intergenic
981272176 4:142857896-142857918 GTATGGGTCTGCAACCTATGAGG - Intergenic
983716733 4:170790515-170790537 AAATGGATCTTAGACTTGTGTGG + Intergenic
984881046 4:184410182-184410204 ATAAGGAGCTGCAACCAGTGAGG - Intronic
989466466 5:41761659-41761681 ATATGGCCCTCAAAGCTGTGAGG - Intronic
989799114 5:45513837-45513859 ATGTGGGTCTGAAATCTATGAGG - Intronic
991024897 5:62018959-62018981 ATCTCCACCTGAAACCTGTGGGG + Intergenic
999258692 5:150224305-150224327 ATATAGGTCTGAATCATGTGAGG + Intronic
1004097496 6:12572631-12572653 ATATGAATCAAAAAACTGTGTGG + Intergenic
1006724700 6:36189402-36189424 ATATGCATATGAAACATGTAGGG + Intergenic
1008144926 6:47879581-47879603 ACCTGGATCGCAAACCTGTGTGG - Exonic
1015186745 6:130425904-130425926 CTATGGATCTGATACCATTGAGG + Intronic
1015633673 6:135255291-135255313 ATCTGGAAATGAAACTTGTGAGG - Intergenic
1015828912 6:137346083-137346105 ACATGGATGTGCAATCTGTGTGG - Intergenic
1016130579 6:140463416-140463438 AAATGGATTTGAAGCCTGAGGGG + Intergenic
1017814057 6:158004200-158004222 AAATGGATCTGAGACCTGCTGGG + Intronic
1020875685 7:13690887-13690909 ACATGGATTTGATACCTTTGGGG + Intergenic
1022544795 7:31176024-31176046 AATGGGATCTGAAACCTCTGGGG - Intergenic
1023388811 7:39687539-39687561 ATACAAATCTGTAACCTGTGTGG - Intronic
1024846304 7:53647021-53647043 ACTTTGATCTGAAAACTGTGAGG - Intergenic
1028738172 7:94241456-94241478 ATATGTATCTGGAACCTTCGTGG + Intergenic
1030241544 7:107331788-107331810 TTATGCTTCTGGAACCTGTGGGG + Intronic
1030734453 7:113029950-113029972 ATATGGATCTGAAATCTCAAAGG - Intergenic
1033950899 7:146783344-146783366 AGGTGGATATGAAATCTGTGAGG - Intronic
1038375072 8:27032176-27032198 ATATGCATATGAAGCCTGGGAGG + Intergenic
1039890007 8:41679449-41679471 ATACTCATCTGAAACTTGTGGGG + Intronic
1040762968 8:50873720-50873742 CTATGGGTCTGAAACCTTAGGGG - Intergenic
1041783601 8:61606548-61606570 TTATTTATCTGAAACCTTTGGGG - Intronic
1044194595 8:89359162-89359184 ATATGGTTCTGAAATCTTTTAGG + Intergenic
1048665738 8:136658518-136658540 ATCTGGATCTGACAGATGTGGGG - Intergenic
1050060294 9:1702110-1702132 ATATGATTCTGAAACATGGGAGG - Intergenic
1050395516 9:5190947-5190969 ATGTTGTTCTGAAACCTTTGGGG - Intergenic
1051230225 9:14948264-14948286 AAATGGAACTGAAACCTTAGAGG + Intergenic
1053673251 9:40392819-40392841 ATAGGAATTTGAAGCCTGTGTGG - Intergenic
1054384355 9:64532885-64532907 ATAGGAATTTGAAGCCTGTGTGG - Intergenic
1054511376 9:65983468-65983490 ATAGGAATTTGAAGCCTGTGTGG + Intergenic
1058644124 9:107114881-107114903 AGATGGGTCTGAAACCTGATGGG - Intergenic
1061774462 9:132951651-132951673 ATATGGATCTGAAACCTGTGAGG - Intronic
1185916205 X:4038181-4038203 AGATGCATCTGAAGCCTGTTAGG + Intergenic
1187197632 X:17103216-17103238 GAATGGATCTGAAAGCAGTGAGG - Intronic
1189435852 X:40991962-40991984 AGAAGGATCTGAAACATGTCAGG - Intergenic
1198154154 X:133941387-133941409 CTCTGGATCTGAAACCTTTCTGG - Intronic
1200416398 Y:2916150-2916172 CTATGTGTCTGAAACCTGGGAGG - Intronic