ID: 1061774464

View in Genome Browser
Species Human (GRCh38)
Location 9:132951668-132951690
Sequence GAGAGCCTTCAGCTATGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061774464_1061774466 6 Left 1061774464 9:132951668-132951690 CCATATCATAGCTGAAGGCTCTC 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1061774466 9:132951697-132951719 GTCCAGCTCCTCCTCTGTGTGGG No data
1061774464_1061774465 5 Left 1061774464 9:132951668-132951690 CCATATCATAGCTGAAGGCTCTC 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061774464 Original CRISPR GAGAGCCTTCAGCTATGATA TGG (reversed) Intronic
910480609 1:87654489-87654511 GAGAGAGCTCAGCTATGTTAGGG + Intergenic
912252776 1:108028403-108028425 GAAAGCCTTGAGCTGTGAGAGGG + Intergenic
921071032 1:211657424-211657446 CAGAGCATTCAGCTGAGATAGGG - Intergenic
1065044700 10:21736856-21736878 GAGAGCCATCAGATTTGATGCGG + Intronic
1067313133 10:45134025-45134047 GAGGGCCTTCAGCAATGTCAGGG + Intergenic
1067396925 10:45929122-45929144 GAAAGCTTTCAGATATAATAGGG + Intergenic
1070915439 10:80151418-80151440 GAGAGCTTTCAGATTTGATGGGG + Exonic
1072811087 10:98462529-98462551 CAGAGCAGTCAGGTATGATAAGG - Intronic
1075007213 10:118839642-118839664 GAGAGCCTTCAGCTAAATTGGGG + Intergenic
1078704469 11:13726993-13727015 GAAAGCCTTCAGAAATGTTATGG - Intronic
1085479700 11:76810974-76810996 GAAACACTTCAGCTATGACAGGG - Intergenic
1086109588 11:83185008-83185030 CAGGGCCTTCAGCTATCATTTGG + Exonic
1086356351 11:86004956-86004978 AAGAGCTTTCAGAGATGATAAGG + Intronic
1091937376 12:4444652-4444674 GAAAGCCATCAGCTATGGTGTGG - Intronic
1096566511 12:52486460-52486482 CAGAGCCTTCTCCTATGAGAAGG + Intergenic
1103202016 12:119095468-119095490 CAGTGCCTTCAGCTATGCAAGGG + Intronic
1103542832 12:121678196-121678218 GAGACCCTACTTCTATGATATGG - Intergenic
1108274167 13:48791153-48791175 GAGAGCCTACAGTTATGCAATGG - Intergenic
1112118837 13:96387123-96387145 GACAGCCTTCTGCAATGAAAAGG + Intronic
1112689699 13:101878086-101878108 CAGAGCCATCAGATAAGATAGGG - Intronic
1121892173 14:97604593-97604615 GAGACCCTATAGCTATGGTAGGG - Intergenic
1130708198 15:86253200-86253222 GAGTTCCTTGAACTATGATAGGG + Intronic
1133724606 16:8525889-8525911 GGGATCATTCAGCTATGATTGGG - Intergenic
1137337414 16:47563928-47563950 GAGATACTTCACCTAGGATAAGG + Intronic
1137465741 16:48707309-48707331 CAGAGCTTTCAGGGATGATATGG - Intergenic
1141267199 16:82507972-82507994 GAGAGCCTGGAACTATGAGAGGG + Intergenic
1143306898 17:5954508-5954530 GAGAGCCCTCAGGTATGATGTGG - Intronic
1147495217 17:40908971-40908993 GAGAGCCTGCAGCTGTGATGAGG - Intergenic
1151768391 17:76143986-76144008 GAGAGCCTTGAGCTAAGTTCAGG - Exonic
1151998275 17:77626888-77626910 TAGACCCTGCAGCTATCATAAGG - Intergenic
1153699390 18:7677639-7677661 GAGAGCCTTCTTCCATGATCAGG + Intronic
1157548909 18:48567127-48567149 GAAAGACTTCTGCTATCATAAGG - Intronic
1158699087 18:59730458-59730480 GAGATCCTTCTGGAATGATATGG + Intergenic
1167027632 19:46932694-46932716 GAGAGCCTTCAGTTATCTCAAGG + Intronic
926429200 2:12768594-12768616 CTGAGCCATCAGCTAGGATAAGG + Intergenic
929365520 2:41151231-41151253 GAGTGCCTTTAGCTATGATCTGG - Intergenic
933325315 2:80828687-80828709 GATAGGCTTCAGCTGTGACAAGG - Intergenic
938779668 2:134573959-134573981 GACAGCCATCAGCTATTATGTGG + Intronic
940909217 2:159195784-159195806 CAGAGCTTTCAGCTGTGATGGGG - Intronic
942942789 2:181639030-181639052 CATAGCCATCAGCTATAATATGG + Intronic
1169624802 20:7553408-7553430 GAGAGCCTGCAGGAATGAAAAGG - Intergenic
1173401557 20:42730670-42730692 GTGAGCATTCAGCATTGATAGGG - Intronic
1179402855 21:41100229-41100251 GAGAGCCATCATCTGTGATATGG + Intergenic
954290128 3:49645295-49645317 GAGGGCCTGCAGCTATTCTAGGG + Intronic
955733378 3:62010988-62011010 GAAAGCCTTCAGCAAAGAGAAGG + Intronic
956040264 3:65138052-65138074 GAGAGCACCCAGCTAAGATAAGG - Intergenic
958954601 3:100453523-100453545 GACTGCCGTCAGCTATGATTGGG + Intronic
959372164 3:105540589-105540611 CATTTCCTTCAGCTATGATATGG - Intronic
971070623 4:23087417-23087439 GACATCCCTCAGCTATGATTTGG - Intergenic
971799956 4:31275972-31275994 GAGAGCATTCAGATATAAAAAGG - Intergenic
973337969 4:48975640-48975662 GAGAACCTTCAGCTGTGATATGG - Intergenic
973665007 4:53150284-53150306 CAGAGCCATCAGCCAAGATAAGG + Intronic
976572963 4:86634820-86634842 GAGAACCTACAGCCATGGTAGGG - Intronic
982941983 4:161570763-161570785 GTGAGCCTGCAGCTATGCTCTGG + Intronic
987859809 5:23470029-23470051 GAGAACCTTTAGCAATGCTAGGG + Intergenic
988047917 5:25982329-25982351 GAGAGTTTTTAGCTTTGATAAGG + Intergenic
1001067803 5:168553035-168553057 GAGATCCTTCAGCAATTGTAGGG - Exonic
1002170482 5:177371661-177371683 GAGAGCCTTGAGCTAAGGCAGGG + Intronic
1008089211 6:47276340-47276362 GAGAACCATCAGCTATGAGTGGG - Intronic
1008348108 6:50454503-50454525 GAAATCCTTCAGCTATAAAAAGG + Intergenic
1027149484 7:75722639-75722661 GAGAGCTTACAGCTAGGAAATGG - Intronic
1034281703 7:149859217-149859239 GGCAGCCCTCAGCTAGGATAGGG - Intronic
1038302852 8:26370749-26370771 GAAAGCCTTCAGTCATGCTATGG + Exonic
1044731677 8:95233235-95233257 GAGATACTTCAGCTATGGGAGGG + Intergenic
1045613573 8:103877937-103877959 GAGATCTTTCACCTCTGATATGG + Intronic
1046038253 8:108871199-108871221 GACAGTCTTCAGCTAAGACATGG - Intergenic
1055050686 9:71977018-71977040 TAGAGCTTGCAGCCATGATAGGG + Intronic
1061512148 9:131067969-131067991 GGGAGCCTCCAGAGATGATACGG - Intronic
1061774464 9:132951668-132951690 GAGAGCCTTCAGCTATGATATGG - Intronic
1188029093 X:25244558-25244580 GAGAGTCGTTAGCTATGACAAGG + Intergenic
1199569042 X:149248723-149248745 GAGAGCCTCCAGCTAAATTAGGG - Intergenic
1201311386 Y:12601028-12601050 GACAGACTTGAGCTTTGATAGGG + Intergenic