ID: 1061774465

View in Genome Browser
Species Human (GRCh38)
Location 9:132951696-132951718
Sequence TGTCCAGCTCCTCCTCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061774458_1061774465 30 Left 1061774458 9:132951643-132951665 CCCCCTCTCCTCACAGGTTTCAG 0: 1
1: 0
2: 4
3: 31
4: 315
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data
1061774462_1061774465 22 Left 1061774462 9:132951651-132951673 CCTCACAGGTTTCAGATCCATAT 0: 1
1: 0
2: 1
3: 1
4: 121
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data
1061774461_1061774465 27 Left 1061774461 9:132951646-132951668 CCTCTCCTCACAGGTTTCAGATC 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data
1061774460_1061774465 28 Left 1061774460 9:132951645-132951667 CCCTCTCCTCACAGGTTTCAGAT 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data
1061774459_1061774465 29 Left 1061774459 9:132951644-132951666 CCCCTCTCCTCACAGGTTTCAGA 0: 1
1: 0
2: 2
3: 27
4: 327
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data
1061774464_1061774465 5 Left 1061774464 9:132951668-132951690 CCATATCATAGCTGAAGGCTCTC 0: 1
1: 0
2: 1
3: 4
4: 66
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061774465 Original CRISPR TGTCCAGCTCCTCCTCTGTG TGG Intronic
No off target data available for this crispr