ID: 1061779959

View in Genome Browser
Species Human (GRCh38)
Location 9:132989642-132989664
Sequence GACACTCCATTGGGGCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061779959_1061779965 -10 Left 1061779959 9:132989642-132989664 CCAGGCCGCCCCAATGGAGTGTC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1061779965 9:132989655-132989677 ATGGAGTGTCCTGTTCCGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 104
1061779959_1061779966 -9 Left 1061779959 9:132989642-132989664 CCAGGCCGCCCCAATGGAGTGTC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1061779966 9:132989656-132989678 TGGAGTGTCCTGTTCCGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1061779959_1061779967 -2 Left 1061779959 9:132989642-132989664 CCAGGCCGCCCCAATGGAGTGTC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1061779967 9:132989663-132989685 TCCTGTTCCGCAGGGGATCCCGG 0: 1
1: 0
2: 1
3: 6
4: 109
1061779959_1061779970 3 Left 1061779959 9:132989642-132989664 CCAGGCCGCCCCAATGGAGTGTC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1061779970 9:132989668-132989690 TTCCGCAGGGGATCCCGGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 77
1061779959_1061779969 2 Left 1061779959 9:132989642-132989664 CCAGGCCGCCCCAATGGAGTGTC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1061779969 9:132989667-132989689 GTTCCGCAGGGGATCCCGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061779959 Original CRISPR GACACTCCATTGGGGCGGCC TGG (reversed) Intronic
903774595 1:25784746-25784768 GACACTCAACTGGGGTGGCCAGG - Exonic
904410727 1:30323257-30323279 GACATTCCAATGGGGCAGTCAGG + Intergenic
906156364 1:43616478-43616500 GAGCCTCAATTGGGGTGGCCTGG + Intronic
923555654 1:234998624-234998646 GCCACTCCTTTAGGGCGGGCGGG - Intergenic
1065625433 10:27624705-27624727 TGCACTCCATTGAGGCTGCCAGG - Intergenic
1069080475 10:64083356-64083378 GACTCTCCATAGGGCAGGCCTGG - Intergenic
1069992880 10:72325725-72325747 AACACCCCACTGGGGGGGCCGGG - Intergenic
1070172134 10:73940847-73940869 GACACTGCGTGGGGGTGGCCTGG + Intergenic
1071984834 10:91039839-91039861 GAGACTTCATTGGGGCTGACAGG - Intergenic
1077242146 11:1516160-1516182 GACACTCCTTTTGGGCAGCTGGG - Intergenic
1077405233 11:2379622-2379644 GACACTCCCAGGGGGCTGCCAGG - Intronic
1083598146 11:63929598-63929620 GATACTTCATTAGGGCAGCCCGG - Intergenic
1092605271 12:10111712-10111734 GACTCGCCCTCGGGGCGGCCTGG - Intergenic
1102338438 12:112102695-112102717 GAGACTCCATTGCGGGGGGCGGG - Intronic
1103833561 12:123800183-123800205 GACATTCCATCAGCGCGGCCAGG - Intronic
1104083780 12:125456694-125456716 GAGACTGCAGTGGGGAGGCCTGG - Intronic
1110602781 13:77395171-77395193 GACACTCCATTCAGGCTCCCTGG - Intergenic
1117016129 14:51519173-51519195 GAGACTCCGTTGGGGTGGCAGGG - Intronic
1119348494 14:73945049-73945071 GACTTTCCATTAGGGCTGCCAGG - Intronic
1119434246 14:74587435-74587457 GAGACTCAGATGGGGCGGCCAGG + Intronic
1119481751 14:74962346-74962368 CCCACTCCACTGGGGAGGCCTGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1123010120 14:105345850-105345872 CCCACTCCACTGGGGCTGCCCGG - Intronic
1128943976 15:71809378-71809400 CACACTCCCTTGCGGGGGCCCGG + Intronic
1148555524 17:48576735-48576757 GGGCCTCCATTGGGCCGGCCAGG + Exonic
1152122796 17:78429037-78429059 GACACTCCATTTGTGCTGGCAGG + Intronic
1152178959 17:78806031-78806053 GACAAAGCATTGGGGCAGCCAGG - Intronic
1160387247 18:78504074-78504096 CACACGGCATTGGGGCTGCCTGG + Intergenic
1163330782 19:16636083-16636105 GTGACTCCATTGGGGCCACCAGG - Intronic
932106114 2:68944235-68944257 CACACTCCTGTGGGGTGGCCAGG + Intergenic
942406740 2:175663892-175663914 AACACTCCACTGGGGTGCCCTGG - Intergenic
947518899 2:230828995-230829017 GACAGTCCCTTGGGGCAGCAAGG - Intergenic
947818190 2:233052008-233052030 GACACTCCATAGGGGTGGGGTGG + Intergenic
948425856 2:237886204-237886226 GACACCCCCGTGGGGCGGCCTGG - Intronic
1179056028 21:37935254-37935276 GACAGACCATTGGGGAGGGCAGG - Intergenic
1185334271 22:50264594-50264616 GACACTCCCTTGGGTCGGCCTGG + Exonic
950386397 3:12663822-12663844 GACAGGACGTTGGGGCGGCCTGG - Exonic
965890850 3:173512064-173512086 GACACTCCCATGGGCCTGCCTGG - Intronic
985090457 4:186357748-186357770 GAGACTGCATTGGGCCTGCCTGG - Intergenic
992409409 5:76490595-76490617 CCCACTCAAGTGGGGCGGCCTGG + Intronic
995841508 5:116447149-116447171 TATACTCCAGTGTGGCGGCCTGG + Exonic
999769612 5:154765397-154765419 GACCCTGCCTTGGGGCGGCGGGG - Intronic
1002419690 5:179139193-179139215 GACACTCCCTGGGTGAGGCCAGG + Intronic
1010028800 6:71250628-71250650 GATACTCCATTGCCTCGGCCTGG + Intergenic
1026566809 7:71496215-71496237 GACCCTGCAGTGGGGAGGCCGGG + Intronic
1026575504 7:71568049-71568071 GAAACTCCACTGGGGCCACCAGG - Intronic
1026874719 7:73872521-73872543 GACACTCCATGGGAACTGCCTGG + Intergenic
1032488510 7:132306266-132306288 GAGACTTCATTGGGGCAGGCAGG + Intronic
1034498401 7:151435333-151435355 GCCACTCCCACGGGGCGGCCGGG + Intronic
1036983552 8:13499206-13499228 GACATTCCATTGGGGCAGGAAGG + Exonic
1045061641 8:98416524-98416546 CACACTCCACTGGGCAGGCCTGG + Intronic
1047088476 8:121546115-121546137 TACATTCCATTGGAGCAGCCTGG + Intergenic
1050163753 9:2743676-2743698 GAATCTGCATTGAGGCGGCCAGG - Intronic
1057916362 9:99058543-99058565 AACACTACATTAGGGCTGCCGGG + Intronic
1058923484 9:109640283-109640305 GAAACGCCATTGTGCCGGCCGGG - Intergenic
1061546767 9:131309078-131309100 GACTCTCCTCTGGGGAGGCCGGG + Exonic
1061779959 9:132989642-132989664 GACACTCCATTGGGGCGGCCTGG - Intronic
1199461835 X:148093790-148093812 CACACTCCGGTGGGGTGGCCAGG + Intergenic
1201180042 Y:11334118-11334140 GGCACTCCATGGGGGCAGCTGGG - Intergenic