ID: 1061780549

View in Genome Browser
Species Human (GRCh38)
Location 9:132993747-132993769
Sequence GACCCGTTCTGGTGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061780546_1061780549 -5 Left 1061780546 9:132993729-132993751 CCGGCTGGACATGCCTCAGACCC No data
Right 1061780549 9:132993747-132993769 GACCCGTTCTGGTGCTCCCCAGG No data
1061780545_1061780549 3 Left 1061780545 9:132993721-132993743 CCACAGAGCCGGCTGGACATGCC No data
Right 1061780549 9:132993747-132993769 GACCCGTTCTGGTGCTCCCCAGG No data
1061780542_1061780549 13 Left 1061780542 9:132993711-132993733 CCAGAGAGGCCCACAGAGCCGGC No data
Right 1061780549 9:132993747-132993769 GACCCGTTCTGGTGCTCCCCAGG No data
1061780544_1061780549 4 Left 1061780544 9:132993720-132993742 CCCACAGAGCCGGCTGGACATGC No data
Right 1061780549 9:132993747-132993769 GACCCGTTCTGGTGCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061780549 Original CRISPR GACCCGTTCTGGTGCTCCCC AGG Intergenic
No off target data available for this crispr