ID: 1061781549

View in Genome Browser
Species Human (GRCh38)
Location 9:132999268-132999290
Sequence GGGGGCTGCAGGGATGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061781529_1061781549 18 Left 1061781529 9:132999227-132999249 CCTGGCCCGGAGACAGGCAGGAC No data
Right 1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG No data
1061781532_1061781549 12 Left 1061781532 9:132999233-132999255 CCGGAGACAGGCAGGACCCAGGG No data
Right 1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG No data
1061781540_1061781549 -4 Left 1061781540 9:132999249-132999271 CCCAGGGTTCCCGGGGGATGGGG No data
Right 1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG No data
1061781530_1061781549 13 Left 1061781530 9:132999232-132999254 CCCGGAGACAGGCAGGACCCAGG No data
Right 1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG No data
1061781542_1061781549 -5 Left 1061781542 9:132999250-132999272 CCAGGGTTCCCGGGGGATGGGGG No data
Right 1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061781549 Original CRISPR GGGGGCTGCAGGGATGCTGC GGG Intergenic
No off target data available for this crispr