ID: 1061782042

View in Genome Browser
Species Human (GRCh38)
Location 9:133001908-133001930
Sequence TTGGTCAGACACTGCCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061782032_1061782042 29 Left 1061782032 9:133001856-133001878 CCTGGATGGAGTCAGGAGACCGA No data
Right 1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG No data
1061782035_1061782042 10 Left 1061782035 9:133001875-133001897 CCGAGGGATGTCACTCTGCTTGG No data
Right 1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG No data
1061782031_1061782042 30 Left 1061782031 9:133001855-133001877 CCCTGGATGGAGTCAGGAGACCG No data
Right 1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061782042 Original CRISPR TTGGTCAGACACTGCCCTCT GGG Intergenic
No off target data available for this crispr