ID: 1061783311

View in Genome Browser
Species Human (GRCh38)
Location 9:133008292-133008314
Sequence GACCCCGCTTCCCCAGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061783311_1061783318 11 Left 1061783311 9:133008292-133008314 CCAGGCGCTGGGGAAGCGGGGTC No data
Right 1061783318 9:133008326-133008348 CCCCGACCCTGCTCAGGGATGGG No data
1061783311_1061783325 20 Left 1061783311 9:133008292-133008314 CCAGGCGCTGGGGAAGCGGGGTC No data
Right 1061783325 9:133008335-133008357 TGCTCAGGGATGGGGGCAGTAGG No data
1061783311_1061783314 6 Left 1061783311 9:133008292-133008314 CCAGGCGCTGGGGAAGCGGGGTC No data
Right 1061783314 9:133008321-133008343 GACACCCCCGACCCTGCTCAGGG No data
1061783311_1061783320 12 Left 1061783311 9:133008292-133008314 CCAGGCGCTGGGGAAGCGGGGTC No data
Right 1061783320 9:133008327-133008349 CCCGACCCTGCTCAGGGATGGGG No data
1061783311_1061783322 13 Left 1061783311 9:133008292-133008314 CCAGGCGCTGGGGAAGCGGGGTC No data
Right 1061783322 9:133008328-133008350 CCGACCCTGCTCAGGGATGGGGG No data
1061783311_1061783313 5 Left 1061783311 9:133008292-133008314 CCAGGCGCTGGGGAAGCGGGGTC No data
Right 1061783313 9:133008320-133008342 AGACACCCCCGACCCTGCTCAGG No data
1061783311_1061783316 10 Left 1061783311 9:133008292-133008314 CCAGGCGCTGGGGAAGCGGGGTC No data
Right 1061783316 9:133008325-133008347 CCCCCGACCCTGCTCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061783311 Original CRISPR GACCCCGCTTCCCCAGCGCC TGG (reversed) Intergenic