ID: 1061788695

View in Genome Browser
Species Human (GRCh38)
Location 9:133046714-133046736
Sequence GAGTGGGCCACACTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061788690_1061788695 -4 Left 1061788690 9:133046695-133046717 CCTTAAAGGAGATCATGGGGAGT 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1061788695 9:133046714-133046736 GAGTGGGCCACACTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061788695 Original CRISPR GAGTGGGCCACACTGGTGGA AGG Intronic
No off target data available for this crispr