ID: 1061789490

View in Genome Browser
Species Human (GRCh38)
Location 9:133051616-133051638
Sequence CAGTGTGGCCGGAGTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061789490_1061789494 -3 Left 1061789490 9:133051616-133051638 CCCTCTACACTCCGGCCACACTG 0: 1
1: 0
2: 3
3: 25
4: 240
Right 1061789494 9:133051636-133051658 CTGACCTTTGCAGTCCTCCCCGG No data
1061789490_1061789497 3 Left 1061789490 9:133051616-133051638 CCCTCTACACTCCGGCCACACTG 0: 1
1: 0
2: 3
3: 25
4: 240
Right 1061789497 9:133051642-133051664 TTTGCAGTCCTCCCCGGGCCAGG No data
1061789490_1061789495 -2 Left 1061789490 9:133051616-133051638 CCCTCTACACTCCGGCCACACTG 0: 1
1: 0
2: 3
3: 25
4: 240
Right 1061789495 9:133051637-133051659 TGACCTTTGCAGTCCTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061789490 Original CRISPR CAGTGTGGCCGGAGTGTAGA GGG (reversed) Intronic
900725945 1:4216418-4216440 CAGTTTTGCATGAGTGTAGAGGG + Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902200462 1:14829763-14829785 TAGTGTGGCCAGAGCATAGAAGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
904575119 1:31500426-31500448 CAGGGTGGCCGAGGTTTAGAGGG + Intergenic
908438151 1:64127125-64127147 AAGTGTGGAAGGAGTTTAGATGG - Intronic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
910589793 1:88918543-88918565 CAGTGGGCCTGGTGTGTAGATGG + Intergenic
911243463 1:95490831-95490853 TAGAGTGGCCGGAGTGGTGATGG + Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
921780121 1:219153091-219153113 AATTGTGACTGGAGTGTAGAGGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923323155 1:232856563-232856585 CAGTGGGGAGGGAGTGTCGATGG - Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
1062810300 10:458457-458479 CGGTGAGGCAGGAATGTAGAGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1066069480 10:31792220-31792242 CACTGGGGCCTGAGGGTAGAGGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067850549 10:49751302-49751324 GAGTGTGGCAGGAGGGTAGTGGG - Intronic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070280499 10:75044770-75044792 TGGTGGGGCCGGAGTGGAGATGG + Intronic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1070976288 10:80608525-80608547 CAGTGTAGCCCGAGTGCAGGGGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1073061205 10:100734946-100734968 GAGTGTGGCAGGAGTTTGGAAGG + Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076273703 10:129178487-129178509 CAGTGTGGAGGGGGTGCAGAGGG - Intergenic
1077185574 11:1234041-1234063 CAGTGTGGCCGGGGTGTCCTGGG + Intronic
1077726921 11:4684033-4684055 CAGTTTGGCCTTAATGTAGAGGG + Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078664422 11:13312965-13312987 CAGTGAGACCGGGGTGGAGAGGG + Intronic
1078729435 11:13962449-13962471 CAGAGGGTCCGGAGTGTAGCTGG + Intergenic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1083174507 11:60941110-60941132 CATTGTGGCAGGTGTGCAGAGGG - Exonic
1084641929 11:70431372-70431394 CAGTGTGGCGTGGGTGTAGAGGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085597865 11:77826602-77826624 CAGTGTAGCAGGAGTGTACTTGG - Intronic
1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG + Exonic
1086308480 11:85508338-85508360 CCTTGTGGCAGGAGTGTACATGG - Intronic
1088391993 11:109324601-109324623 CAGTGTGGTCTCAGTCTAGAGGG - Intergenic
1090469711 11:126969365-126969387 CAGTGTGGCAGGTGTGAAGGTGG + Intronic
1090620179 11:128553677-128553699 GAGGGTGGCGGGAGTGTGGAGGG - Intronic
1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG + Intergenic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097223394 12:57463068-57463090 CTGTGTGGTCTGTGTGTAGAAGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1103816045 12:123657376-123657398 CGGTGGGGCCGGACTGAAGAGGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1106044877 13:26129639-26129661 CAGTGTGACTGCTGTGTAGAGGG - Intergenic
1106395772 13:29379517-29379539 CACTGTGGCCGTGGTGTAAAAGG + Intronic
1106810268 13:33351885-33351907 AAGTGTAGCAGAAGTGTAGAGGG - Intergenic
1109723413 13:66306830-66306852 AAATGTGGCCAGATTGTAGAGGG - Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1113602798 13:111582652-111582674 CTGTGTCCCAGGAGTGTAGAGGG + Intergenic
1113864530 13:113512380-113512402 CCCAGGGGCCGGAGTGTAGACGG + Intronic
1113864542 13:113512452-113512474 CTCAGTGGCCGGAGTGTAGATGG + Intronic
1113864599 13:113512719-113512741 GAAGGGGGCCGGAGTGTAGACGG + Intronic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121307952 14:92918626-92918648 CAGAGAGGCCGGAGTGTGGCAGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1137017525 16:35392741-35392763 GAGTGTGGCCTGAATGTGGAAGG - Intergenic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141880173 16:86852937-86852959 AAGCGTAGCCAGAGTGTAGATGG + Intergenic
1142431119 16:90027939-90027961 CAGGGTGGTAGGAGTGTGGAAGG + Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143362372 17:6382557-6382579 CAATGTGGCCGGAGGCTGGATGG - Intergenic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148241001 17:45999226-45999248 CAGTGTGGTCAGAGTTTACAGGG - Intronic
1148603201 17:48909077-48909099 GAGGGTGGCCGGAATGGAGACGG - Intronic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG + Intergenic
1151879214 17:76885114-76885136 CAGTGAGGCCGTGGTGGAGATGG + Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1203167025 17_GL000205v2_random:106846-106868 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1154121051 18:11653045-11653067 CACTGTGGTAGGAGTGTAGGTGG - Intergenic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157081980 18:44535255-44535277 CAGTGTGGCAGCAATGTAAAGGG + Intergenic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1158392233 18:57053029-57053051 CAGTATGGCTGGAGTGTGCATGG - Intergenic
1159891960 18:73961402-73961424 CAGTGGGGTCAGAGTGTACAAGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1163399980 19:17086263-17086285 CAGTGTGGCCGGTGGGTCCAAGG - Intronic
1163497905 19:17657248-17657270 CAGCGTGGCCGGAATGGAGGAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1167412642 19:49354124-49354146 CGGTGAGGCAGGAGTGTTGACGG - Intronic
1167513525 19:49909598-49909620 CTGTGTGGCCGGAGTCTGGGTGG + Exonic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
934937129 2:98473513-98473535 CAGTGTAGGTGCAGTGTAGAGGG + Intronic
935492039 2:103733505-103733527 CAGTGTGGCGGGGATGTAGGTGG + Intergenic
936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG + Intergenic
938181624 2:129189844-129189866 TAGGGTGGCCTGAGTGTAGCAGG + Intergenic
938229393 2:129645551-129645573 GAGTGTGGCAGGTGTGTGGAGGG + Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941287714 2:163634482-163634504 CAGTTTGGCTGTGGTGTAGATGG - Intronic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
946187654 2:217990234-217990256 GAGTGTGGCTGGTGTATAGATGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1173343369 20:42175302-42175324 CAGTGTGGCTGCAGCCTAGAGGG - Intronic
1175390706 20:58625642-58625664 CAGTGAGGCCGGGCTGCAGAGGG - Intergenic
1175743339 20:61435969-61435991 AAGTGTGGCCAGACTGGAGAAGG - Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1176268069 20:64220942-64220964 CACTGAGGCCGGATTGTGGAGGG - Intronic
1176334542 21:5583714-5583736 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1176393215 21:6237234-6237256 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1176468204 21:7078940-7078962 CAGGTTGGCAGGAGGGTAGAAGG + Intronic
1176491765 21:7460718-7460740 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1176508877 21:7677665-7677687 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1177326905 21:19602354-19602376 AAGTGTTGCTGCAGTGTAGATGG + Intergenic
1179363608 21:40735551-40735573 CAGTGTGTCTGGAATGTAGGTGG - Intronic
1180142007 21:45898601-45898623 CCGTGAGGACGGTGTGTAGAGGG - Intronic
1181861421 22:25822135-25822157 CAGTGTGGCTGGAATGTAACGGG - Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182336264 22:29585509-29585531 CAGTGTGGCCGCTGACTAGAAGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950331328 3:12158449-12158471 CAGTATGGCCGGAGTGAGGGAGG + Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG + Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957842957 3:85694676-85694698 GAGTGTGTCTGGAGTATAGATGG - Intronic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
965677374 3:171212179-171212201 CAGTGCAGCCGGAGTGGAGGAGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
968947083 4:3670778-3670800 CAGTGTGTCCGGAGCGTGCAGGG + Intergenic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969423706 4:7111726-7111748 CAGTGTGGCAGCAGTGGTGAAGG + Intergenic
972583507 4:40416029-40416051 CACTGTGGCCCCAGTGTGGAAGG + Intergenic
973152327 4:46903482-46903504 CAGTGTAGCCTAAGTGTACAGGG + Intronic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
977656732 4:99530915-99530937 CAAAGTGGCCAGAGTGTAGCAGG - Intronic
978141848 4:105326813-105326835 CAGTGAGGCCCCATTGTAGAAGG + Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
982020569 4:151199612-151199634 CAGTGTGGCAGGAAAGAAGAGGG - Intronic
982166456 4:152617875-152617897 CAGTGTGGCCTGAGAGTGCAAGG - Intergenic
982968991 4:161955934-161955956 CAGTGTTCCGAGAGTGTAGAAGG - Intronic
988713326 5:33800239-33800261 CAGTGTCGCAGGATTGCAGAAGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
994081714 5:95714572-95714594 CAGTGTGACCGGAGTGGTGGAGG + Intronic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
1001411335 5:171514600-171514622 AAGAGTGGCCGGAGGGTAGGAGG + Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1003989975 6:11476597-11476619 CAGTGTGACAGCAGTGGAGATGG + Intergenic
1005250418 6:23939734-23939756 CAGTGTGGTCTGAGTGTGGTTGG - Intergenic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1006440317 6:34049763-34049785 CAGTGTGGCCGTGGTGTTTATGG - Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011438632 6:87365018-87365040 CAGTGTGGCCCGACTGATGAGGG + Exonic
1012503746 6:99920577-99920599 CAGTGAGGCCACAGTGTGGAGGG + Exonic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015154554 6:130077688-130077710 CAGTGTGGCTGGAGTTTCCAGGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018915888 6:168132134-168132156 CAGTGCGGCCGGAGCTTAGCAGG - Intergenic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1019521094 7:1460816-1460838 CAGTGAGGCCTGTGTGTAGGTGG + Intergenic
1021625395 7:22588243-22588265 CAGACTGGCCTGAGTGCAGAAGG + Intronic
1022880761 7:34584773-34584795 CAGTGAGCCAGGAGTGTTGACGG - Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023311628 7:38893198-38893220 CAATGTGGCTGTAGTGTAGAAGG - Intronic
1027166150 7:75835662-75835684 CAGTGGTGCCGGCGTGGAGACGG + Intergenic
1028551421 7:92071272-92071294 CAGTTTAGCAGGAGTGTAGAGGG + Intronic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1033951315 7:146788193-146788215 CCGTGTGGCCTGAGAGCAGAGGG + Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038131406 8:24735991-24736013 CAGTGGGGCAGGTGGGTAGAAGG + Intergenic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1041706608 8:60852988-60853010 CAGAGTGGTGGGAGTGTGGACGG + Exonic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1047800189 8:128301221-128301243 CAGTGTAGCCAGACTGTAGTTGG + Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049673454 8:143879591-143879613 CAGTGTGGCAGGTGTGGACAGGG - Intergenic
1049705611 8:144040700-144040722 CTGTGTGTCCGAAGTGTTGAAGG - Exonic
1049811427 8:144575247-144575269 GAGTGTGGCCGAAGTGTACAGGG - Intronic
1051368167 9:16335880-16335902 CAGTGTGGCAGGAGTCAGGAAGG + Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1058578766 9:106431927-106431949 CACTGTTGCTGGAGTGTAAACGG - Intergenic
1059155347 9:111984216-111984238 CAATGTGGCAGGAATGTACAAGG - Intergenic
1059760696 9:117334610-117334632 CACTGTGGCTGGTGTGTAAAAGG - Intronic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1059983273 9:119796584-119796606 CAGTTTGGCTGGATTGTAGGGGG + Intergenic
1060050853 9:120377123-120377145 CAGTCTGGAGGGAGTGGAGAAGG + Intergenic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061676076 9:132216521-132216543 CAGTGGGGCAGGGGTGGAGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062426960 9:136510535-136510557 CAGGGAGGCCGGAGTGTGGCCGG - Intronic
1203427089 Un_GL000195v1:51204-51226 CAGGTTGGCAGGAGGGTAGAAGG - Intergenic
1203439113 Un_GL000195v1:171861-171883 CAGGTTGGCAGGAGGGTAGAAGG + Intergenic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1189846414 X:45142740-45142762 CACTGTGGTCTGTGTGTAGAAGG + Intergenic
1190157337 X:48004611-48004633 CAGTGTGTTGGGAGTGTAGGGGG + Intronic
1190173107 X:48127496-48127518 CAGTGTGTTGGGAGTGTAGGGGG + Intergenic
1195792895 X:108608156-108608178 CATTGTGGGTGGAGTGTAAATGG - Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196777065 X:119348151-119348173 CAGAGTGGTGGGAGTGAAGATGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198432907 X:136585860-136585882 CAGTAAGGCCGGACTGTAGCTGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199593395 X:149488388-149488410 CAGTGTGGCGGGAATCTAAAAGG + Intronic
1199598624 X:149527043-149527065 CAGTGTGGCGGGAATCTAAAAGG - Intronic
1201370658 Y:13259523-13259545 CAATGTGGCTGGAAAGTAGATGG - Intronic