ID: 1061790405

View in Genome Browser
Species Human (GRCh38)
Location 9:133056049-133056071
Sequence CTGGTAGAACATCTGCCGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790405_1061790411 15 Left 1061790405 9:133056049-133056071 CCTATCGGCAGATGTTCTACCAG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1061790411 9:133056087-133056109 GTGGAAGAGTACGTATGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 132
1061790405_1061790412 16 Left 1061790405 9:133056049-133056071 CCTATCGGCAGATGTTCTACCAG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1061790412 9:133056088-133056110 TGGAAGAGTACGTATGGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 133
1061790405_1061790408 10 Left 1061790405 9:133056049-133056071 CCTATCGGCAGATGTTCTACCAG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1061790408 9:133056082-133056104 TGAATGTGGAAGAGTACGTATGG 0: 1
1: 0
2: 1
3: 6
4: 124
1061790405_1061790407 -4 Left 1061790405 9:133056049-133056071 CCTATCGGCAGATGTTCTACCAG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1061790407 9:133056068-133056090 CCAGTTATGCGACTTGAATGTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1061790405_1061790409 11 Left 1061790405 9:133056049-133056071 CCTATCGGCAGATGTTCTACCAG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1061790409 9:133056083-133056105 GAATGTGGAAGAGTACGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 94
1061790405_1061790410 14 Left 1061790405 9:133056049-133056071 CCTATCGGCAGATGTTCTACCAG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1061790410 9:133056086-133056108 TGTGGAAGAGTACGTATGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790405 Original CRISPR CTGGTAGAACATCTGCCGAT AGG (reversed) Exonic
906145295 1:43557056-43557078 CTGCTAGGACAGCTGCCAATAGG - Intronic
919234780 1:194826885-194826907 CTGGTTGAAAAACTGCCTATTGG + Intergenic
924093578 1:240526953-240526975 CTGGTAGAACATCAGCTAATAGG - Intronic
1065422237 10:25557944-25557966 CAAGTAGGACATCTGCAGATGGG - Intronic
1067950475 10:50731778-50731800 CTGTTGGAACATGTGTCGATAGG - Intergenic
1068137749 10:52966970-52966992 CTAGTACTACATCTGCAGATAGG - Intergenic
1070885818 10:79897011-79897033 CTGTTGGAACATGTGTCGATAGG - Intergenic
1081550660 11:44108856-44108878 ATGGTAGAACATCTGCAAAATGG - Intronic
1088570387 11:111218205-111218227 CTTGTAGAATGTCTGTCGATGGG - Intergenic
1101775003 12:107785582-107785604 ATGGTAGATCATTTGCCAATGGG - Intergenic
1105614753 13:22001557-22001579 CTGGTAGAATAACTGCCCACAGG + Intergenic
1109619274 13:64880175-64880197 CTGGTAGGCCATCAGCTGATGGG - Intergenic
1112759774 13:102681047-102681069 CAGGTAGAAATTCTGCTGATTGG - Intergenic
1116755182 14:48939551-48939573 CTAGTACAACACCTGCCAATAGG + Intergenic
1122121502 14:99555982-99556004 TTGGTAGAAGATCAGCCGATCGG - Intronic
1131263828 15:90904006-90904028 CTGGTAGCAGCTCTGCCGCTAGG - Intronic
1132647475 16:1005662-1005684 CTGGAAGAAAATCTGCCAATCGG - Intergenic
1134899002 16:17917629-17917651 CAGGTACAACATCTGCTGAGGGG + Intergenic
1138008013 16:53355406-53355428 CTGGGAGAAAATCTGCAGCTCGG + Intergenic
1142602567 17:1061365-1061387 CTGGTGGTACATCTGCCCAGAGG - Intronic
1142848885 17:2694888-2694910 CTGGAAGAACATCTGCCAGGAGG - Exonic
1143750553 17:9023644-9023666 TTGGCAGAACATTTGCAGATAGG + Intronic
1145218697 17:21071185-21071207 ATGAAAGAACATCTGCAGATCGG - Intergenic
1146685293 17:34837377-34837399 CTGGTAGAACATCTTCAGGGTGG - Intergenic
1147364121 17:39949306-39949328 CTGGTCGAAGATCTGCCCCTGGG + Intergenic
1152373411 17:79904712-79904734 CTGGAAGAACAGCTGCCATTGGG + Intergenic
1156933106 18:42669150-42669172 CTGGTAGAACACCTGACTAGGGG - Intergenic
928015996 2:27657609-27657631 CTGGTAGAGGAGCTGCCGACAGG + Exonic
928603575 2:32924111-32924133 CAGGTAGATCATCTGACGTTGGG + Intergenic
929513271 2:42582689-42582711 TTGGTAGAGCATCTGCTGACTGG + Intronic
932134706 2:69218129-69218151 CTGTTAGAACCTTTGCCGCTTGG - Intronic
933032042 2:77340987-77341009 CTGGTAGAACATCTAAAAATTGG - Intronic
940969609 2:159881438-159881460 CAGGTAGAACATCTGCAGGCTGG + Intronic
941618677 2:167752992-167753014 ATGATAGAACATCTGCCTGTAGG + Intergenic
943757667 2:191573745-191573767 TTGCTGGAACATCTGCCAATGGG + Intergenic
965122189 3:164574462-164574484 TTTGTAGAACATCTACCAATTGG + Intergenic
965779708 3:172271962-172271984 CTGGTAGAACATGTGTGAATAGG + Intronic
966384469 3:179381125-179381147 CTCGCAGAACAACTGCCTATAGG + Intronic
971813366 4:31456557-31456579 GTGGAAGAACACCTGCAGATGGG + Intergenic
976956393 4:90905623-90905645 CTGGTAAAACATTTGCTTATTGG + Intronic
995069542 5:107903640-107903662 GTGGTGGGACATCTGCTGATAGG + Intronic
1007211259 6:40194983-40195005 CTGGTAGAACACCTCCCCCTTGG + Intergenic
1012062503 6:94506375-94506397 CTAATAGAACATCTGAAGATTGG - Intergenic
1016475832 6:144426568-144426590 TTGGTAGAACATGTGCAGAAAGG - Intronic
1020734493 7:11930208-11930230 AGTGTAGAACATCTGCAGATGGG + Intergenic
1032975945 7:137222271-137222293 CTGGTACAACCTCTGCCCAGTGG - Intergenic
1038157717 8:25006434-25006456 CTGGTACAACTGCTGCAGATGGG + Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1061790405 9:133056049-133056071 CTGGTAGAACATCTGCCGATAGG - Exonic
1189502986 X:41582078-41582100 ATGGTAGAACATGGGCAGATGGG - Intronic
1193059163 X:77186250-77186272 CTTGTAGAGCTTCTGCCGAGAGG - Intergenic
1196187501 X:112760339-112760361 CTGGTATAACATCTACGGATGGG + Intergenic
1196889578 X:120279038-120279060 CTGGTAGAATCTCTGGTGATGGG + Intronic