ID: 1061790418

View in Genome Browser
Species Human (GRCh38)
Location 9:133056111-133056133
Sequence GGGCCCCCCTCAGTGTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790418_1061790426 0 Left 1061790418 9:133056111-133056133 CCCTGAGACACTGAGGGGGGCCC 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1061790426 9:133056134-133056156 GTGGGACCCAGGGACCAAAGCGG 0: 1
1: 0
2: 1
3: 32
4: 281
1061790418_1061790430 27 Left 1061790418 9:133056111-133056133 CCCTGAGACACTGAGGGGGGCCC 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790418_1061790423 -10 Left 1061790418 9:133056111-133056133 CCCTGAGACACTGAGGGGGGCCC 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1061790423 9:133056124-133056146 AGGGGGGCCCGTGGGACCCAGGG 0: 1
1: 0
2: 4
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790418 Original CRISPR GGGCCCCCCTCAGTGTCTCA GGG (reversed) Intronic