ID: 1061790424

View in Genome Browser
Species Human (GRCh38)
Location 9:133056131-133056153
Sequence CTTTGGTCCCTGGGTCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790424_1061790432 20 Left 1061790424 9:133056131-133056153 CCCGTGGGACCCAGGGACCAAAG 0: 1
1: 0
2: 2
3: 28
4: 205
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66
1061790424_1061790430 7 Left 1061790424 9:133056131-133056153 CCCGTGGGACCCAGGGACCAAAG 0: 1
1: 0
2: 2
3: 28
4: 205
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790424 Original CRISPR CTTTGGTCCCTGGGTCCCAC GGG (reversed) Intronic