ID: 1061790425

View in Genome Browser
Species Human (GRCh38)
Location 9:133056132-133056154
Sequence GCTTTGGTCCCTGGGTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790425_1061790430 6 Left 1061790425 9:133056132-133056154 CCGTGGGACCCAGGGACCAAAGC 0: 1
1: 0
2: 0
3: 33
4: 220
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790425_1061790432 19 Left 1061790425 9:133056132-133056154 CCGTGGGACCCAGGGACCAAAGC 0: 1
1: 0
2: 0
3: 33
4: 220
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790425 Original CRISPR GCTTTGGTCCCTGGGTCCCA CGG (reversed) Intronic