ID: 1061790427

View in Genome Browser
Species Human (GRCh38)
Location 9:133056140-133056162
Sequence CAGAGACCGCTTTGGTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790427_1061790432 11 Left 1061790427 9:133056140-133056162 CCCAGGGACCAAAGCGGTCTCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66
1061790427_1061790430 -2 Left 1061790427 9:133056140-133056162 CCCAGGGACCAAAGCGGTCTCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790427 Original CRISPR CAGAGACCGCTTTGGTCCCT GGG (reversed) Intronic