ID: 1061790428

View in Genome Browser
Species Human (GRCh38)
Location 9:133056141-133056163
Sequence TCAGAGACCGCTTTGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790428_1061790432 10 Left 1061790428 9:133056141-133056163 CCAGGGACCAAAGCGGTCTCTGA 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66
1061790428_1061790430 -3 Left 1061790428 9:133056141-133056163 CCAGGGACCAAAGCGGTCTCTGA 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790428 Original CRISPR TCAGAGACCGCTTTGGTCCC TGG (reversed) Intronic