ID: 1061790429

View in Genome Browser
Species Human (GRCh38)
Location 9:133056148-133056170
Sequence GAAGAGTTCAGAGACCGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790429_1061790435 24 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790435 9:133056195-133056217 GGCAAGAGCACTCGCCTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 93
1061790429_1061790430 -10 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790429_1061790432 3 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66
1061790429_1061790436 25 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790436 9:133056196-133056218 GCAAGAGCACTCGCCTGTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790429 Original CRISPR GAAGAGTTCAGAGACCGCTT TGG (reversed) Intronic