ID: 1061790429

View in Genome Browser
Species Human (GRCh38)
Location 9:133056148-133056170
Sequence GAAGAGTTCAGAGACCGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790429_1061790435 24 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790435 9:133056195-133056217 GGCAAGAGCACTCGCCTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 93
1061790429_1061790436 25 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790436 9:133056196-133056218 GCAAGAGCACTCGCCTGTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1061790429_1061790430 -10 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790429_1061790432 3 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790429 Original CRISPR GAAGAGTTCAGAGACCGCTT TGG (reversed) Intronic
901829311 1:11882422-11882444 GGAGAGCTCTGAGACAGCTTAGG + Intergenic
906231857 1:44171261-44171283 AAACAGTTCAGAGAGCCCTTTGG + Intergenic
910444190 1:87283919-87283941 GAGAAGTTCAGAAACAGCTTAGG - Intergenic
911078738 1:93907915-93907937 GAAGAGAGCAGAAACCACTTAGG + Intronic
911263471 1:95715392-95715414 GAAGACTTCAGTGACATCTTTGG - Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916598722 1:166271900-166271922 GAAGGGGTGAGAGACCTCTTTGG + Intergenic
917414746 1:174797275-174797297 GAAGAATTCAGTGACTTCTTAGG - Intronic
918246730 1:182667087-182667109 GAAGTCTTCAGAGACCACCTGGG - Intronic
919312767 1:195932336-195932358 GAAAATTTCAGAGACATCTTTGG - Intergenic
923632008 1:235656504-235656526 AAAGAGTTAAGAGACCCTTTAGG + Intergenic
924001557 1:239558877-239558899 GAGGAGCTCAGAGACCAGTTAGG - Intronic
1073003066 10:100299657-100299679 GAAGAGCTCAGACATCACTTTGG + Exonic
1081730846 11:45370706-45370728 GAAGGGATCAGAGAAGGCTTTGG + Intergenic
1083944749 11:65917664-65917686 GACGACTTCACGGACCGCTTGGG - Exonic
1084949644 11:72657541-72657563 GCAGAGGCCAGAGACCCCTTTGG - Intronic
1086549819 11:88042718-88042740 GGAGAGTGCAGAGACCTCATGGG + Intergenic
1087791622 11:102411894-102411916 GAAGAGTTCAGACATACCTTGGG - Intronic
1091448660 12:559372-559394 AAGGAGTTCCGAGACCGCTGGGG + Exonic
1095183982 12:39179744-39179766 GAATAGTTCAGAGTCCTTTTGGG - Intergenic
1098977960 12:76923470-76923492 GAAGAGTGCAGAGATAGGTTTGG - Intergenic
1100458266 12:94773974-94773996 CAAGAATTCAGAGACAGCTTAGG + Intergenic
1100987245 12:100214380-100214402 TCAGAGTTCAGAGACTACTTGGG + Intronic
1101753440 12:107602143-107602165 GAATAGTTCAGAGACCCTTAGGG - Intronic
1107246336 13:38300793-38300815 AAAGAGATCAGAGACCAGTTAGG - Intergenic
1107901566 13:45020525-45020547 GAAGAGTTCAAGGCCAGCTTGGG + Intronic
1111916422 13:94365276-94365298 TAAGAGTTCATAGACAGCCTTGG + Intronic
1111935276 13:94550874-94550896 GCAGAGTTCAGAGAAGGGTTTGG + Intergenic
1117163573 14:53012286-53012308 GAAGAGTTAAGAAACCACTATGG - Intergenic
1118191270 14:63582826-63582848 CAAGAGTTCAAAGCCAGCTTGGG + Intergenic
1119572318 14:75686082-75686104 TATGAGTTCAGAAACTGCTTTGG - Intronic
1120478812 14:85023374-85023396 GAGGAGTTGAGAGAAGGCTTCGG - Intergenic
1120762610 14:88299037-88299059 GAAGAGTTTATAGCCAGCTTTGG - Intronic
1125897659 15:43316104-43316126 CAAGAGATCAGAGAGGGCTTTGG - Intergenic
1127354248 15:58182794-58182816 GAGGACTTCGGAGACCACTTAGG + Intronic
1128613077 15:69089298-69089320 GAAGAGATCACAGACCCCTTAGG + Intergenic
1130953360 15:88609845-88609867 GCAGAGTTCAGAGACAGAGTAGG - Intergenic
1133149845 16:3819398-3819420 GAGGAGGTGAGAGACAGCTTTGG + Intronic
1137362390 16:47830749-47830771 GAAAAGTTCAGTGACAGCTAAGG - Intergenic
1138084635 16:54122274-54122296 GCAGAGTGCAGAGACCTCTAAGG - Intergenic
1141023192 16:80517535-80517557 GAAGAGTTCAGAGACTTTTGTGG - Intergenic
1144701383 17:17343163-17343185 GGAGAGTTCAGGGAAGGCTTAGG + Intronic
1145411939 17:22673628-22673650 GAACATTTCAGAGACCACTGAGG - Intergenic
1155515435 18:26620057-26620079 GAGGAGTTCAGAGACCTGTGAGG - Intronic
1156157533 18:34321215-34321237 GAGGAGTTCAGAAACAGCTCAGG - Intergenic
1156396164 18:36701894-36701916 GATGACTTCAGAGATGGCTTAGG - Intronic
1159032399 18:63244779-63244801 GAAACTTTCAGAGCCCGCTTTGG + Intronic
1159430631 18:68348274-68348296 GTAGAGTTGAGAGACAGCTGTGG + Intergenic
1161422711 19:4184635-4184657 GAGGAGTTCACAGGCTGCTTGGG - Intronic
1163471091 19:17497372-17497394 GAGGAGTTCACGGAGCGCTTCGG + Exonic
1166572016 19:43802914-43802936 GAAGAGTTCACAGCCCGGTAGGG - Intronic
1166708850 19:44924474-44924496 GCAGAGGTCAGAGACCTCTCTGG + Intergenic
1166710818 19:44936069-44936091 GCAGAGGTCAGAGACCTCTCAGG + Intergenic
925583669 2:5440783-5440805 AAAGAGTTCAGAGACCACACTGG + Intergenic
927440479 2:23112675-23112697 TAAGAGTTCACAGACTCCTTGGG + Intergenic
928913055 2:36442142-36442164 GAAGTGTTCACAGACCACATCGG - Intronic
929895373 2:45955453-45955475 TAAGAGTTCAGAGAAAGCTGGGG - Intronic
933731128 2:85457000-85457022 GAAGTGGTCAGAGCCCTCTTTGG - Intergenic
935070829 2:99692199-99692221 GAAGAGTTAAGAGTCCTCTCTGG - Intronic
942806754 2:179939799-179939821 GAAAAGCTGAGAGACCACTTAGG - Intergenic
1174528772 20:51194332-51194354 CAAGAGCTCAGGGACCGCTGGGG + Intergenic
1175081487 20:56424438-56424460 GAAAAGTTAAGATACAGCTTCGG + Intronic
1178764511 21:35437149-35437171 GAAGCCTTCAAAGACAGCTTAGG - Intronic
1185393605 22:50575850-50575872 GAAGAGTCCAGAAGCAGCTTAGG - Intronic
954759014 3:52860718-52860740 GAAGAGGTCAGATTCCGGTTGGG + Intronic
955618196 3:60831839-60831861 GAATAGTTCAGAAACCTCCTAGG + Intronic
956053703 3:65276428-65276450 GAAGAGTACAGAACCCTCTTGGG - Intergenic
957822114 3:85390453-85390475 GCAGAGTTCAGAGAAAGTTTTGG - Intronic
963082856 3:141410412-141410434 GAAGAGTCCAGAGAAGTCTTAGG + Intronic
966336999 3:178879561-178879583 GAAGTGTTCAGGGAACACTTGGG - Intergenic
969451766 4:7277890-7277912 GCAGAGTTCAGGGACAGCTCCGG + Intronic
973921182 4:55686825-55686847 GAATGATTCAGAGACCACTTTGG + Intergenic
974422820 4:61699618-61699640 GAAGAGTTAATAGACCCATTAGG + Intronic
986583711 5:9292811-9292833 GAAGTGTCTAGAGACAGCTTTGG + Intronic
990085223 5:51968509-51968531 GAAGAGTTCAGAGTTGGCTGGGG + Intergenic
990446775 5:55900484-55900506 GAAGAGTTCAAGGGCAGCTTCGG - Intronic
990953383 5:61320296-61320318 GAAGAGTTCACATACAACTTCGG + Intergenic
995727198 5:115193735-115193757 CAAGAGCTCAGAGACTGCTTGGG + Intergenic
1001516704 5:172360415-172360437 TAAGAGCTCAGAGACCGCCTTGG - Intronic
1002437313 5:179239517-179239539 GAAGAGTGCAGAGACAGATGAGG + Intronic
1004714825 6:18206943-18206965 GATGATTTCAGAGGCCCCTTTGG + Intronic
1006606950 6:35264717-35264739 GAAGAGGTCAGAGAAAGGTTAGG - Intronic
1008453781 6:51684679-51684701 GAAGATTTTAGAGACTGCTAGGG + Intronic
1009779674 6:68254449-68254471 GAAAAGTTCAAAGAACACTTGGG - Intergenic
1012709162 6:102576518-102576540 GAAGAGTGCAGAGGCAGCATAGG - Intergenic
1012713667 6:102640525-102640547 GAAGAGGTGAGAGATCTCTTTGG + Intergenic
1015397834 6:132754963-132754985 GAAGAGTTCAAAGACAGCCTGGG + Intronic
1017675593 6:156810593-156810615 CAAGAGATCAGAGACCCCTGAGG - Intronic
1019501753 7:1368358-1368380 GAGGAATTCAGAGAGCGCTGGGG + Intergenic
1020543753 7:9496154-9496176 CAAGAGTTCAAACCCCGCTTGGG - Intergenic
1021359805 7:19697782-19697804 GAAGACTTCAGAAACTTCTTTGG + Exonic
1024273377 7:47658959-47658981 GAAGTGTTCAGAGCCTGCTGGGG + Exonic
1027339372 7:77189653-77189675 GATGAGATCAGAGACAGCTTGGG - Intronic
1029571374 7:101371830-101371852 GATGAGCTCAGAGACTGGTTGGG + Intronic
1034071641 7:148191658-148191680 GGAGAGTTCAGAGAGCTCTCTGG + Intronic
1036614888 8:10380537-10380559 GAAGAGTCCAGAGTCTACTTTGG - Intronic
1038500333 8:28038293-28038315 GAAGAGTTAAGAGAGCATTTGGG - Intronic
1041257765 8:55994046-55994068 GAAGAAATCAGAGACTCCTTTGG - Intronic
1044708750 8:95034659-95034681 GAAGAGGACACAGACCACTTAGG - Intronic
1046962804 8:120127511-120127533 GAGGATTTCAGAGAACTCTTGGG + Intronic
1055038371 9:71842549-71842571 GAAGAGTTCACACAGGGCTTGGG - Intergenic
1056809243 9:89751465-89751487 CAAGAGAGCAGAGACCCCTTAGG + Intergenic
1057174977 9:92989578-92989600 GAAGACTTCAAAGTCCTCTTTGG - Intronic
1059654972 9:116349283-116349305 CAAGAACTCAGAGACAGCTTTGG + Intronic
1061790429 9:133056148-133056170 GAAGAGTTCAGAGACCGCTTTGG - Intronic
1188407806 X:29833478-29833500 GAAGTGTTCAGGGACTCCTTGGG - Intronic
1188554347 X:31395141-31395163 AAAGAGTTCAAAGACCCCATAGG + Intronic
1188661371 X:32762878-32762900 GAAGAACTGAGAGACTGCTTAGG + Intronic
1193679464 X:84500910-84500932 GAAGTGTTCACAGACCACTAAGG + Intronic
1201865758 Y:18652388-18652410 GAAGAGTGCAGGGACAGCATGGG + Intergenic