ID: 1061790430

View in Genome Browser
Species Human (GRCh38)
Location 9:133056161-133056183
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790419_1061790430 26 Left 1061790419 9:133056112-133056134 CCTGAGACACTGAGGGGGGCCCG 0: 1
1: 0
2: 1
3: 6
4: 140
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790427_1061790430 -2 Left 1061790427 9:133056140-133056162 CCCAGGGACCAAAGCGGTCTCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790418_1061790430 27 Left 1061790418 9:133056111-133056133 CCCTGAGACACTGAGGGGGGCCC 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790428_1061790430 -3 Left 1061790428 9:133056141-133056163 CCAGGGACCAAAGCGGTCTCTGA 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790425_1061790430 6 Left 1061790425 9:133056132-133056154 CCGTGGGACCCAGGGACCAAAGC 0: 1
1: 0
2: 0
3: 33
4: 220
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790424_1061790430 7 Left 1061790424 9:133056131-133056153 CCCGTGGGACCCAGGGACCAAAG 0: 1
1: 0
2: 2
3: 28
4: 205
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74
1061790429_1061790430 -10 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790430 9:133056161-133056183 TGAACTCTTCCACTTCACGTCGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type