ID: 1061790432

View in Genome Browser
Species Human (GRCh38)
Location 9:133056174-133056196
Sequence TTCACGTCGGCCTTCATCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790429_1061790432 3 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66
1061790428_1061790432 10 Left 1061790428 9:133056141-133056163 CCAGGGACCAAAGCGGTCTCTGA 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66
1061790424_1061790432 20 Left 1061790424 9:133056131-133056153 CCCGTGGGACCCAGGGACCAAAG 0: 1
1: 0
2: 2
3: 28
4: 205
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66
1061790427_1061790432 11 Left 1061790427 9:133056140-133056162 CCCAGGGACCAAAGCGGTCTCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66
1061790425_1061790432 19 Left 1061790425 9:133056132-133056154 CCGTGGGACCCAGGGACCAAAGC 0: 1
1: 0
2: 0
3: 33
4: 220
Right 1061790432 9:133056174-133056196 TTCACGTCGGCCTTCATCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790432 Original CRISPR TTCACGTCGGCCTTCATCTC CGG Intronic