ID: 1061790435

View in Genome Browser
Species Human (GRCh38)
Location 9:133056195-133056217
Sequence GGCAAGAGCACTCGCCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790431_1061790435 2 Left 1061790431 9:133056170-133056192 CCACTTCACGTCGGCCTTCATCT 0: 1
1: 0
2: 0
3: 14
4: 87
Right 1061790435 9:133056195-133056217 GGCAAGAGCACTCGCCTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 93
1061790429_1061790435 24 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790435 9:133056195-133056217 GGCAAGAGCACTCGCCTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790435 Original CRISPR GGCAAGAGCACTCGCCTGTC TGG Intronic