ID: 1061790436

View in Genome Browser
Species Human (GRCh38)
Location 9:133056196-133056218
Sequence GCAAGAGCACTCGCCTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790429_1061790436 25 Left 1061790429 9:133056148-133056170 CCAAAGCGGTCTCTGAACTCTTC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1061790436 9:133056196-133056218 GCAAGAGCACTCGCCTGTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1061790431_1061790436 3 Left 1061790431 9:133056170-133056192 CCACTTCACGTCGGCCTTCATCT 0: 1
1: 0
2: 0
3: 14
4: 87
Right 1061790436 9:133056196-133056218 GCAAGAGCACTCGCCTGTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790436 Original CRISPR GCAAGAGCACTCGCCTGTCT GGG Intronic