ID: 1061790914

View in Genome Browser
Species Human (GRCh38)
Location 9:133058372-133058394
Sequence AGCGTGGGGAGCCTCGCCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061790907_1061790914 16 Left 1061790907 9:133058333-133058355 CCAGTCTCGCTTGGCTCTCATGA 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1061790914 9:133058372-133058394 AGCGTGGGGAGCCTCGCCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1061790904_1061790914 28 Left 1061790904 9:133058321-133058343 CCAGGCCACAGGCCAGTCTCGCT 0: 1
1: 0
2: 2
3: 16
4: 211
Right 1061790914 9:133058372-133058394 AGCGTGGGGAGCCTCGCCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1061790903_1061790914 29 Left 1061790903 9:133058320-133058342 CCCAGGCCACAGGCCAGTCTCGC 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1061790914 9:133058372-133058394 AGCGTGGGGAGCCTCGCCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1061790906_1061790914 23 Left 1061790906 9:133058326-133058348 CCACAGGCCAGTCTCGCTTGGCT 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1061790914 9:133058372-133058394 AGCGTGGGGAGCCTCGCCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123
1061790902_1061790914 30 Left 1061790902 9:133058319-133058341 CCCCAGGCCACAGGCCAGTCTCG 0: 1
1: 0
2: 0
3: 33
4: 343
Right 1061790914 9:133058372-133058394 AGCGTGGGGAGCCTCGCCCATGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061790914 Original CRISPR AGCGTGGGGAGCCTCGCCCA TGG Exonic
901884033 1:12210217-12210239 AGTGTGGGGAGCCTTGGTCAAGG - Intergenic
904661885 1:32091618-32091640 AGAGTTGGGATCCTGGCCCATGG + Intronic
906262867 1:44406811-44406833 ACCGTGGGCGGCCTCGCCCGGGG - Intronic
906718880 1:47991274-47991296 AGCGTGTGGAGCCTCCTGCAGGG + Intronic
912232065 1:107805957-107805979 AGTGTGGGGAGGCTGGCTCAGGG + Intronic
912948150 1:114101773-114101795 AGCATGAGGAACCTGGCCCAAGG - Intronic
921046828 1:211483729-211483751 AGCATCAGGAGCCTCGCCTAAGG + Intronic
923292733 1:232562162-232562184 AGCCTGGGCAGCCTTGCCAAGGG - Intergenic
923517606 1:234710420-234710442 AGAGTGGGGATCCCCACCCAGGG - Intergenic
924797058 1:247300213-247300235 AGCTTGGGGAGCATGGGCCAAGG + Exonic
1068169578 10:53376037-53376059 AGCGTGGGGAACATCACACATGG + Intergenic
1070922502 10:80196923-80196945 AGCGTCCGGAGCCTCACCAAGGG + Intronic
1071078747 10:81784482-81784504 AGCGGGGGGAGTCTCGGGCATGG - Intergenic
1075065307 10:119285362-119285384 GCCTTGGGGAGCCTGGCCCAGGG - Intronic
1077416248 11:2425637-2425659 AGCCTGAGGACCCCCGCCCAGGG - Intergenic
1077516079 11:3002915-3002937 AGCATGGTGAGCCTGGCCCAAGG + Intronic
1092262806 12:6961474-6961496 AGACTGGGGAGCTTCACCCACGG - Intergenic
1093978805 12:25452751-25452773 TGCGTTGGGAGCCTAGGCCAGGG - Intronic
1097540366 12:60935604-60935626 GGCCTGAGGAGCCTAGCCCATGG - Intergenic
1103468484 12:121161098-121161120 AGCATGGGCAGACTCGCCTATGG - Intronic
1103988214 12:124781040-124781062 AGCCTGGGGACCCTGTCCCAGGG + Intronic
1104978328 12:132561908-132561930 AGATTTGGGAGCCTGGCCCAAGG + Intronic
1105586654 13:21751187-21751209 AAGTTGGGGAGCCTGGCCCAAGG - Intergenic
1106141376 13:27014994-27015016 AGCACTGGGAGCCTCCCCCACGG + Intergenic
1108528057 13:51302642-51302664 AGCGTGGGGTGCCTCTGCCTGGG - Intergenic
1108768393 13:53663550-53663572 AGCTTTGGGAGCCTCTCCCTGGG + Intergenic
1108854551 13:54776045-54776067 AGTGGGGGGAGCCGCGGCCATGG - Intergenic
1119325666 14:73758608-73758630 AGCCTGTGGAGCCTCGCGCGGGG - Intronic
1122248848 14:100424154-100424176 AGCCTGGGAGGCCTCGCCCGTGG - Intronic
1124093710 15:26629366-26629388 GGCGTGGAGAACCTCGCCCTGGG + Intronic
1125348114 15:38740302-38740324 AGCCTGGGTGGCCTCGGCCAGGG - Intergenic
1127327663 15:57911461-57911483 AGCCTGTGGAGCCTCCCCGAGGG - Intergenic
1129691717 15:77717677-77717699 AGCCTCGGGAGCCTGGGCCAGGG + Intronic
1132859788 16:2064535-2064557 AGGGAGGGGAGCCTCACCTACGG - Intronic
1137606026 16:49787438-49787460 ACCGTGGCGAGCCACGGCCATGG + Intronic
1141093668 16:81147763-81147785 AGAGCGGGGAGTCTCGTCCATGG + Intergenic
1142256382 16:89015697-89015719 GGTGTGGGGAGCCTCGTGCAGGG - Intergenic
1142867847 17:2801690-2801712 AGCATGGGCAGCCTGGCCCTGGG + Intronic
1144836634 17:18159763-18159785 AGGGTGGGAAACCTCTCCCATGG + Intronic
1148209624 17:45800363-45800385 AGCCTGCGGGGCCTCCCCCAGGG + Intronic
1151479345 17:74361242-74361264 AGCGAGGGGAGCCTCGCAGAGGG + Intronic
1152283541 17:79399274-79399296 AGCGGGGATAGCCTCACCCACGG - Intronic
1155336276 18:24768603-24768625 AGAGTGAGGAGCATCGCCAAGGG - Intergenic
1157422838 18:47560513-47560535 GGGGTGGGGAGCCTCCCACAAGG + Intergenic
1160565631 18:79785150-79785172 AGCGTGCGGTGGCTCGGCCAGGG - Intergenic
1160767343 19:814333-814355 TGAGTGGGGAGGCTGGCCCAGGG - Intronic
1160872494 19:1283584-1283606 TGCCGGGGCAGCCTCGCCCAGGG + Intergenic
1161302750 19:3550956-3550978 AGCCTGGGCACCCTCCCCCACGG - Intronic
1162913846 19:13864143-13864165 AGTGTGTGGAGCCTCAGCCAGGG + Intronic
1163712491 19:18855054-18855076 AGCGCGCGGGGCCTCGCCCATGG + Intronic
1163816215 19:19466038-19466060 AGAGTTGGGAGCCCAGCCCAGGG + Intronic
1167444371 19:49528588-49528610 ATCATGGGGAGCGTCGCTCAGGG - Exonic
1168288786 19:55347184-55347206 GGCGTGGGGGGGCTGGCCCAGGG - Exonic
926895614 2:17684299-17684321 AGCTGTGGGAGCCTCGACCAGGG - Intronic
929962221 2:46505357-46505379 GGTGTGGGGAGCCGGGCCCAGGG + Intronic
930124240 2:47783552-47783574 GGCGAGGGGAGGCTCGCACAGGG + Intronic
930652726 2:53978505-53978527 AGTGTGGGTAGCCTAGCACAAGG + Intronic
932338117 2:70942650-70942672 AGTGTGAGAAGCCTTGCCCAGGG - Intronic
947792784 2:232877309-232877331 AGGGTGAGGAGCCTGGTCCAGGG + Intronic
948300709 2:236904792-236904814 TGGGAGGTGAGCCTCGCCCAGGG - Intergenic
948456174 2:238105653-238105675 GGCGGGGAGAGCCTGGCCCATGG + Intronic
949058354 2:241942117-241942139 GGTGTGGGGAGCCCCGCACAAGG + Intergenic
1169405322 20:5316907-5316929 AGCGGGGGCAGCCTCTCGCACGG + Intergenic
1170154929 20:13260872-13260894 AGCCTGGGGAGGCTCAGCCAGGG + Intronic
1170658634 20:18315204-18315226 AGCCTGGGGATCCGGGCCCAGGG + Exonic
1173621839 20:44442776-44442798 AGCCTGGGGAGCCCTTCCCAAGG - Intergenic
1173800274 20:45890837-45890859 CGCGTGGAGAGCTTCGCCCACGG - Exonic
1174414838 20:50359855-50359877 AGAGGGAGGAGCCTGGCCCAGGG + Intergenic
1174587738 20:51621940-51621962 AGGGTGGGGAGCATCAACCACGG - Intronic
1175791988 20:61745679-61745701 AGCCTGGGGACCCTGTCCCATGG + Intronic
1175980475 20:62736165-62736187 AGCCTGGGGTGCCTCGGGCAGGG + Intronic
1179437748 21:41373912-41373934 AGTGTGTGGAGCCTGTCCCAGGG - Intronic
1181027277 22:20133275-20133297 AGCCTGGGGAGCCTGGCCTGGGG + Intronic
1181027703 22:20135349-20135371 AGGGTCGGGAGCCTGGCCTAGGG - Intronic
1181438587 22:22924202-22924224 ATCCTGGGGAGTCTCTCCCACGG + Intergenic
1183189430 22:36312258-36312280 AGGGTGGGGTGCCCCTCCCAGGG - Intronic
1183414722 22:37675715-37675737 AGTGTGGGGACCCCCCCCCAAGG + Intronic
1184192473 22:42904185-42904207 AGCATGGGGAGCCTGGCCGACGG - Intronic
1184464243 22:44659582-44659604 GCAGTGGGGAGCCTCTCCCAGGG - Intergenic
950480304 3:13239611-13239633 TGCTTGGGGGGCCTCCCCCATGG - Intergenic
953908551 3:46880973-46880995 AGGGTGGGCATCCTGGCCCATGG - Intronic
955479782 3:59377754-59377776 AGGGTGGGGAGCCTCCCCTGAGG + Intergenic
960446762 3:117758770-117758792 AGTGTGGGGAGCCCCGCCAACGG - Intergenic
966923046 3:184627015-184627037 AGCGTGTGGAGCCTCTGTCAAGG + Intronic
966974017 3:185069571-185069593 AGCGTGGGGAGCTGCTCCCTGGG - Intergenic
968655786 4:1777928-1777950 TGCCTGGGGAGCCCCACCCATGG - Intergenic
970449997 4:16157026-16157048 TTAGTGGGGAGACTCGCCCAGGG + Intergenic
973112205 4:46410616-46410638 AGGGTGGGGAACCTCACACAGGG + Intronic
975132007 4:70840011-70840033 ACCATGGGCAGCCCCGCCCAAGG - Intergenic
982137733 4:152287999-152288021 AGCGTGGGAAACCTATCCCAAGG - Intergenic
985542970 5:495387-495409 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985542981 5:495422-495444 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985542992 5:495457-495479 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543003 5:495492-495514 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543014 5:495527-495549 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543025 5:495562-495584 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543036 5:495597-495619 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543047 5:495632-495654 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543058 5:495667-495689 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543069 5:495702-495724 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543080 5:495737-495759 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543091 5:495772-495794 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543102 5:495807-495829 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543113 5:495842-495864 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543124 5:495877-495899 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543135 5:495912-495934 AGCGTGGGGAGGGTCGGCGATGG - Intronic
985543146 5:495947-495969 AGCGTGGGGAGGGTCGGCGATGG - Intronic
986082257 5:4407511-4407533 AGCCTGAGGATCCTGGCCCAGGG + Intergenic
986858973 5:11904323-11904345 CGCGGGAGGAGCCTCGCCCTCGG - Intergenic
998449130 5:142220829-142220851 AGTGTGGGGAGCTTGGGCCAAGG + Intergenic
998773605 5:145573522-145573544 AGGGTGGGGAACATCGCACATGG - Intronic
1009797768 6:68494625-68494647 AGAGTGGGGCGCCTCACCCGGGG + Intergenic
1018345120 6:162892022-162892044 AGCAGGGGGGGCCTTGCCCAGGG - Intronic
1019896255 7:3985554-3985576 AGGTTGGGGAGGATCGCCCAAGG + Intronic
1020009172 7:4799250-4799272 CGGGTGGGGAGCCTCACCCTGGG - Exonic
1025255645 7:57382343-57382365 AGAGTGAGGGGCCTGGCCCAGGG - Intergenic
1026824194 7:73571075-73571097 AGGGTGGGGTGCCTGGCCCTCGG - Intronic
1034976386 7:155451150-155451172 AGAGTGGTGAGCATCTCCCAGGG - Intergenic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1040016299 8:42702967-42702989 ATCGAGAGGAGCCTTGCCCAGGG - Intronic
1041961962 8:63628047-63628069 AGCGTGGGGAGAAGCACCCAAGG + Intergenic
1043479036 8:80634071-80634093 AGTGTGGGGAGGCTGGCCAAGGG + Exonic
1045956383 8:107912441-107912463 AGTGTGGGGAGGCACACCCATGG + Intronic
1047259176 8:123241022-123241044 AACGCGGGGATTCTCGCCCATGG + Intronic
1049310811 8:141932867-141932889 AGCCTGGGCTGCCTCGCACAGGG + Intergenic
1049790343 8:144469541-144469563 TGAGTGTGGAGCCTGGCCCAGGG + Exonic
1060701020 9:125748267-125748289 CGCGCGGGGAGCCTCGCCCCGGG - Intronic
1061790914 9:133058372-133058394 AGCGTGGGGAGCCTCGCCCATGG + Exonic
1062238898 9:135525605-135525627 AGAGTTTGGAGACTCGCCCAAGG + Intronic
1062396493 9:136354922-136354944 AGGCTGGGGAGGCTGGCCCAGGG + Intronic
1188754009 X:33937717-33937739 AACGTGGGGAACCATGCCCATGG + Intergenic