ID: 1061791527

View in Genome Browser
Species Human (GRCh38)
Location 9:133061648-133061670
Sequence TGTCCCCTAGGTCCCCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061791527_1061791534 -3 Left 1061791527 9:133061648-133061670 CCCCTTTGGGGACCTAGGGGACA No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061791527 Original CRISPR TGTCCCCTAGGTCCCCAAAG GGG (reversed) Intergenic
No off target data available for this crispr