ID: 1061791534

View in Genome Browser
Species Human (GRCh38)
Location 9:133061668-133061690
Sequence ACAAGCAGGGCATGGAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061791516_1061791534 29 Left 1061791516 9:133061616-133061638 CCCAGAAGTCACGTGCTCGGTCC No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data
1061791517_1061791534 28 Left 1061791517 9:133061617-133061639 CCAGAAGTCACGTGCTCGGTCCC No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data
1061791528_1061791534 -4 Left 1061791528 9:133061649-133061671 CCCTTTGGGGACCTAGGGGACAA No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data
1061791523_1061791534 6 Left 1061791523 9:133061639-133061661 CCTCTGAAGCCCCTTTGGGGACC No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data
1061791522_1061791534 7 Left 1061791522 9:133061638-133061660 CCCTCTGAAGCCCCTTTGGGGAC No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data
1061791529_1061791534 -5 Left 1061791529 9:133061650-133061672 CCTTTGGGGACCTAGGGGACAAG No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data
1061791521_1061791534 8 Left 1061791521 9:133061637-133061659 CCCCTCTGAAGCCCCTTTGGGGA No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data
1061791527_1061791534 -3 Left 1061791527 9:133061648-133061670 CCCCTTTGGGGACCTAGGGGACA No data
Right 1061791534 9:133061668-133061690 ACAAGCAGGGCATGGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061791534 Original CRISPR ACAAGCAGGGCATGGAGACA TGG Intergenic
No off target data available for this crispr