ID: 1061793498

View in Genome Browser
Species Human (GRCh38)
Location 9:133070978-133071000
Sequence ACTCTGCAGGGACCCCAACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 2, 1: 0, 2: 2, 3: 11, 4: 151}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061793485_1061793498 15 Left 1061793485 9:133070940-133070962 CCCCCTGGGAGTCCCCAGCCCCT 0: 2
1: 1
2: 5
3: 67
4: 549
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793486_1061793498 14 Left 1061793486 9:133070941-133070963 CCCCTGGGAGTCCCCAGCCCCTG 0: 2
1: 0
2: 8
3: 72
4: 477
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793492_1061793498 -3 Left 1061793492 9:133070958-133070980 CCCCTGCACAGCCTCTTCTCACT 0: 2
1: 0
2: 6
3: 63
4: 544
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793493_1061793498 -4 Left 1061793493 9:133070959-133070981 CCCTGCACAGCCTCTTCTCACTC 0: 2
1: 0
2: 4
3: 89
4: 1212
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793494_1061793498 -5 Left 1061793494 9:133070960-133070982 CCTGCACAGCCTCTTCTCACTCT 0: 2
1: 0
2: 2
3: 42
4: 460
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793487_1061793498 13 Left 1061793487 9:133070942-133070964 CCCTGGGAGTCCCCAGCCCCTGC 0: 2
1: 1
2: 7
3: 55
4: 570
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793488_1061793498 12 Left 1061793488 9:133070943-133070965 CCTGGGAGTCCCCAGCCCCTGCA 0: 2
1: 0
2: 7
3: 57
4: 583
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793490_1061793498 2 Left 1061793490 9:133070953-133070975 CCCAGCCCCTGCACAGCCTCTTC 0: 2
1: 1
2: 5
3: 79
4: 644
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793489_1061793498 3 Left 1061793489 9:133070952-133070974 CCCCAGCCCCTGCACAGCCTCTT 0: 2
1: 2
2: 2
3: 95
4: 733
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151
1061793491_1061793498 1 Left 1061793491 9:133070954-133070976 CCAGCCCCTGCACAGCCTCTTCT 0: 2
1: 1
2: 7
3: 77
4: 771
Right 1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG 0: 2
1: 0
2: 2
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061793498 Original CRISPR ACTCTGCAGGGACCCCAACA TGG Exonic
900804652 1:4759540-4759562 ACTCTGCAGTGACCATAACCAGG + Intronic
902618430 1:17636605-17636627 GCTCTGCAGTGACCCAAACTGGG - Intronic
904998137 1:34647360-34647382 TCTCTGCAGAGACCCAGACAAGG + Intergenic
905124945 1:35709625-35709647 GCTCTCCAGGGACACCAACTAGG - Intergenic
906077908 1:43065499-43065521 ACTGTGCAGGGCCCCGATCAGGG + Intergenic
906130213 1:43451362-43451384 GCTCTGGAGGGACCCGGACAGGG - Exonic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
907618656 1:55952716-55952738 TTTCTGCAGGCACCCCAAAAGGG + Intergenic
907878464 1:58519074-58519096 ACACTGCAGAGACCCCAGAAAGG + Intronic
907951272 1:59186443-59186465 CCTCTGCAGTTACCCCAAGAGGG + Intergenic
909553881 1:76931111-76931133 GCTATGCAGGTCCCCCAACAGGG - Intronic
911346242 1:96700156-96700178 ATTCAGCAGGGACCCCAGAAAGG - Intergenic
916023324 1:160813616-160813638 GCTCTGCAGGGACAACAGCATGG - Exonic
918342305 1:183578070-183578092 ACTCTGCAGGGACACAGGCAGGG - Intronic
919247679 1:195009660-195009682 ACTCTGCAAAGACCACAAAATGG - Intergenic
922968301 1:229711140-229711162 ACTCAGCAGAGACCCCAGAAGGG + Intergenic
924150506 1:241124639-241124661 ACTCTGCAGGAAGCCCAGAATGG - Intronic
924489260 1:244519451-244519473 ACACAGCAGTGGCCCCAACAGGG - Intronic
1064115909 10:12577249-12577271 ACTGGGCTGGGAACCCAACACGG - Intronic
1064991735 10:21262436-21262458 ACTCTTCAGAGACCCCCATAGGG - Intergenic
1066013701 10:31217323-31217345 ACTCCCCATGGACCCCAACCAGG + Intergenic
1067077658 10:43197356-43197378 TCTGTGCAGGGACCCAAAGAAGG + Intronic
1067208163 10:44237174-44237196 CCTCTACAGGAAGCCCAACATGG + Intergenic
1071968093 10:90873156-90873178 ACTCTGCAGGCACCAGTACATGG + Intronic
1074464719 10:113671130-113671152 AGTCTGCTGGGACCTCAGCAGGG + Intergenic
1075953753 10:126504793-126504815 CCTCTGCGGGGGCCCCCACAGGG + Exonic
1077365494 11:2159921-2159943 CTTCTGCAGGGACCCCTCCAGGG + Exonic
1078006741 11:7537844-7537866 ACAGTGCAGGTACTCCAACAAGG - Intronic
1078877218 11:15410766-15410788 ACTCTCCAGGCAGCCCTACATGG - Intergenic
1079855355 11:25596034-25596056 ACTCTGCTGGGAGCTAAACATGG + Intergenic
1079980243 11:27143556-27143578 ACTCTGCAGAGACCACAATTAGG - Intergenic
1084289868 11:68155684-68155706 TCTATGCAGGGACCCCATGAGGG + Exonic
1088742892 11:112781216-112781238 ACTCTGCATTGGCCCCAAGAGGG + Intergenic
1089050916 11:115545147-115545169 ACTCTACAGGGACAGCAACAAGG + Intergenic
1090832526 11:130428988-130429010 ACTCTGCAGGGATCCGAACAGGG - Exonic
1091833619 12:3568657-3568679 ACTTTGCAGGGACCCCACCCAGG - Intronic
1095965561 12:47864787-47864809 ACTCTGGAGGGACCCTTCCAGGG + Intronic
1096770641 12:53933994-53934016 GCTCTGCAGGGATCCATACAGGG - Intergenic
1101750260 12:107577581-107577603 ACTCTGCAGGAAGCCCATCAAGG + Intronic
1102960928 12:117092885-117092907 ACTGTTCAGAGACCCTAACAAGG + Intronic
1103271502 12:119677445-119677467 ACCCTACAGGGTACCCAACAGGG + Intronic
1114551575 14:23535407-23535429 AGGCTGCAGGGACCCCAGCTGGG + Intronic
1120560853 14:85990545-85990567 ACCTTCCAGGAACCCCAACATGG - Intergenic
1122410781 14:101525278-101525300 ACTTTGCAGAGGCCCCAAGAGGG + Intergenic
1122935541 14:104954376-104954398 ACTCTTCCAGGACCCCAGCACGG + Exonic
1124338914 15:28877158-28877180 ACTCTGCAGGAAGCCCACCCTGG - Intergenic
1126062753 15:44799699-44799721 TCTCTGCAGGGACTCCAATGAGG - Intergenic
1129221405 15:74133770-74133792 ACTCAGGAGGGGCACCAACAGGG - Exonic
1129559645 15:76552873-76552895 ACTCTCCAGGGACCCCAGTCTGG + Intronic
1130015219 15:80180886-80180908 TCTCTGCAGTGATCCCACCAAGG + Intronic
1130432257 15:83860371-83860393 AGCCTTCAGGGACCCCTACATGG - Intronic
1136243402 16:28958712-28958734 ACTCTGCAGGGGCTCCGACTAGG - Exonic
1138756231 16:59489122-59489144 ACTGTGCAGGGAGCACAATAAGG + Intergenic
1139683058 16:68580506-68580528 GCTCTTCAGGTTCCCCAACATGG - Intergenic
1140455067 16:75100178-75100200 AATGTGCAGGCACCCCAACCAGG - Intronic
1141720949 16:85754945-85754967 ACTCTGCAGGGACCTGAGCCCGG + Intergenic
1142094442 16:88231998-88232020 ACTCTGCATGGACCCAGGCATGG + Intergenic
1142134043 16:88443608-88443630 CCTCTGCAGGGGTCCCCACAGGG - Intergenic
1144558586 17:16303108-16303130 ACTTTTCTGGGACCCAAACATGG - Intronic
1146484791 17:33234353-33234375 ACTCTGCAGGGGCCCAGCCAGGG - Intronic
1146490503 17:33278061-33278083 ACTATGCAGGGATCCGAAAAAGG - Intronic
1147616080 17:41828703-41828725 ACTCTGCATGAACCCTAACCTGG - Intronic
1148060566 17:44833104-44833126 ACTGAGCGGGGAACCCAACAAGG - Intergenic
1151364221 17:73606647-73606669 GCTCTGCAGGGAACCAAACCTGG - Intronic
1152699924 17:81813690-81813712 ACCCTGCTGGGACCCCAGCTAGG + Exonic
1153333340 18:3896952-3896974 ACTGAGCAGGGAACCCAGCAAGG - Intronic
1153642667 18:7169914-7169936 GCTGTGCAGAGACCCCCACAAGG - Intergenic
1153710356 18:7793023-7793045 ACTCTGCAAGGACCAAATCAAGG + Intronic
1154151054 18:11906983-11907005 CATCTGCATGGACCCCACCAAGG + Intronic
1157175440 18:45447414-45447436 TCTCTGCAGCAACCCAAACATGG - Intronic
1157322486 18:46645341-46645363 ATTCAGCAGGAACCCCCACACGG + Intronic
1165039659 19:33060028-33060050 TCTCTGCTGGGACCGCCACATGG + Intronic
1165311091 19:35030037-35030059 AATGTGCAGGGACCCCAAGTAGG - Intergenic
1167216688 19:48170143-48170165 CCTCTGCAGACACCCCGACATGG + Intronic
1167308144 19:48720498-48720520 ACTCGGCAGGGGCCCAGACAAGG + Intergenic
1168129766 19:54310811-54310833 TCTCTCCAGGGACCACAACAGGG + Intronic
1168440833 19:56365749-56365771 CCTCTGCAGGAACCAGAACAAGG + Intronic
926001623 2:9338105-9338127 ACTCCGCCAGCACCCCAACAGGG - Intronic
926632185 2:15146762-15146784 GCTCAGCAGGGAGCCCCACATGG + Intergenic
934529710 2:95077237-95077259 AACCTGCAGGGACCCTACCAGGG + Intergenic
935578053 2:104731186-104731208 TGTCTGCAGTGACCCCTACATGG - Intergenic
936481850 2:112891930-112891952 CCTCTGTAGGGAACCCAAGAGGG - Intergenic
938257136 2:129868287-129868309 ACCCTCCAGGGTCGCCAACAGGG + Intergenic
941567855 2:167130914-167130936 ACTCTGCAGGGCTACCAATAGGG - Intronic
942212388 2:173684581-173684603 GCTTTGCAGTGACCCCTACAAGG - Intergenic
945937762 2:215920592-215920614 ACTCTTCAGGGACCCAGGCAAGG + Intergenic
947212839 2:227723613-227723635 AAACTGCATTGACCCCAACACGG + Intergenic
947761952 2:232609834-232609856 CCTCTGCAGGGACCCGGCCAGGG + Intronic
948427218 2:237895652-237895674 ACTCTTCAGGGACCCCTGCCGGG - Intronic
948681033 2:239634842-239634864 ATGGTGCAGGGACCCCAGCAGGG + Intergenic
1169140626 20:3225523-3225545 ACCCTCCAGGAACCCCCACATGG - Intergenic
1170431762 20:16282765-16282787 ACTGTGTAGGGCCCCCAGCATGG - Intronic
1170864215 20:20138446-20138468 ACTCAGCTGGCACCCCAAGAGGG - Intronic
1171464019 20:25315353-25315375 ACTGTGCAGAGACCCCATCTGGG + Intronic
1173623833 20:44456896-44456918 TCTCTGCTCGGACCCCAGCACGG + Intronic
1176934106 21:14846315-14846337 ACTCTGCATGGAAGCCACCAAGG + Intergenic
1178935660 21:36859472-36859494 ACTCCACTGGGACCCCCACAGGG + Intronic
1180154700 21:45972328-45972350 ACTCTGCAGGGAGCTGAACATGG - Intergenic
1181629598 22:24143620-24143642 TCTCTGCCAGGCCCCCAACAAGG - Intronic
1181962201 22:26630291-26630313 ACTCTACAGAGACACCAGCATGG - Intronic
1182351593 22:29702966-29702988 GCCCTGCAGGGACCCCAGCCTGG + Intergenic
1184259333 22:43305691-43305713 ACTCGGCAGGGCCTCCACCACGG + Intronic
1184639370 22:45861138-45861160 ACTCTGCAGGAGCCCCAGCACGG - Intergenic
951241180 3:20287840-20287862 CCTGTGCAGGGTCCCCACCAAGG - Intergenic
953230959 3:41064656-41064678 ACTCTTCTGGGACACAAACATGG + Intergenic
958675468 3:97264492-97264514 AAACTGCAGGGACCCAAAGAGGG + Intronic
961449463 3:126995928-126995950 TCTGTGCAGGGACCGCCACAGGG - Intronic
963654227 3:148024864-148024886 ATTCAGCAGGAACCCCAAAAAGG + Intergenic
969331288 4:6474640-6474662 CCACTGCAGGGTCCCCAGCATGG - Intronic
969614500 4:8244492-8244514 AGTCTCCAGGGACCCCAACAAGG - Intergenic
970897189 4:21117662-21117684 GCTCTGCAGCTTCCCCAACACGG - Intronic
973904745 4:55517704-55517726 ACTCTGCAGTGAAACCAACTGGG + Intronic
982687086 4:158503763-158503785 ATTCTGCAGAGTCCCCACCATGG - Intronic
983228937 4:165110793-165110815 CCTCTGAAAGGACCCAAACAAGG - Intronic
985025077 4:185732562-185732584 ACTCTGCAGGGGCCCCAGGAGGG - Intronic
985352346 4:189078449-189078471 ACTCTGCAGGGACTTTAATAAGG - Intergenic
985542270 5:492527-492549 ACTTTTCAGGGAGCCCAAGAGGG + Intronic
986687417 5:10286839-10286861 ACTCTGCAGGGAGCAGATCATGG - Intronic
988358228 5:30203464-30203486 ACTCTGCAGGTTTCCTAACAGGG + Intergenic
993653006 5:90544489-90544511 CATCTGTGGGGACCCCAACATGG - Intronic
1002132392 5:177089619-177089641 ACTCAGCAGGACCCCCAACAGGG - Exonic
1002911518 6:1494589-1494611 AGTCAGCACGGACCCCCACAGGG - Intergenic
1002927951 6:1615442-1615464 ACTCGGCAGGGCCCCCAGCCGGG - Intergenic
1004900215 6:20186570-20186592 AATCTGGAGGGTCCCCAACAAGG + Intronic
1005698886 6:28379644-28379666 TCTCTGAAGGGACACCTACACGG + Exonic
1012169784 6:96002994-96003016 ACTCAGCTGTCACCCCAACATGG + Intergenic
1016749778 6:147619886-147619908 CCTCTGCAGTGACTCCATCAGGG - Intronic
1017774322 6:157669130-157669152 ACTCTGCATCAACCCCAACAGGG + Intronic
1018729762 6:166639813-166639835 ACCCAGGAGAGACCCCAACAGGG - Intronic
1019427731 7:985256-985278 ACCCAGCAGGGACACAAACACGG - Exonic
1026635477 7:72078253-72078275 ACTCTGCAGCTACCCCGAGAAGG + Intronic
1036588484 8:10147006-10147028 CCTCTGCCGGTAACCCAACAAGG - Intronic
1040636516 8:49280620-49280642 AAACTGCAGGGAACCTAACAAGG - Intergenic
1041382495 8:57265394-57265416 ACTCTGTAGAGTCCCCACCAGGG - Intergenic
1045687076 8:104723171-104723193 ACAGTGCAGGGATCCCACCAGGG - Intronic
1045689579 8:104746622-104746644 TCTCTGCAAGGGCCCCTACAGGG + Intronic
1045991546 8:108314480-108314502 ACTCTCCAGGAACCCCCACATGG - Intronic
1048416466 8:134232618-134232640 TCTCTGAATGTACCCCAACAAGG - Intergenic
1049158784 8:141084328-141084350 ACCCTGCAGAGTCCCCTACAGGG + Intergenic
1053464461 9:38295225-38295247 ACTTGGCAGTGATCCCAACAAGG - Intergenic
1056101063 9:83301141-83301163 ACACTGCAGGGCCCCCCCCAGGG - Intronic
1059339854 9:113591548-113591570 ACTTTGCAGTGACCCCAAAGTGG + Intronic
1060596778 9:124853383-124853405 GCTTCGCAGGGACCCCACCATGG + Intergenic
1061211114 9:129194020-129194042 ACTCTCGAGGGGCCCCAGCATGG - Intergenic
1061283342 9:129609607-129609629 CCTCCCCAGGGGCCCCAACAGGG - Intronic
1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG + Exonic
1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG + Intronic
1061993390 9:134172295-134172317 ACTCTGCAGGGATGCCCCCATGG + Intergenic
1062044003 9:134416874-134416896 GTGCAGCAGGGACCCCAACATGG - Intronic
1062606665 9:137351572-137351594 GCTCTGCAGGGACCACAGCCTGG + Intronic
1186069477 X:5802893-5802915 ACCCTGACGGGACCCCAAAAGGG + Intergenic
1186421557 X:9430874-9430896 ACTGTGCAGACACTCCAACAAGG - Intergenic
1187389004 X:18873605-18873627 ACTCTGCAGGAGCCCCTGCACGG - Intergenic
1190233298 X:48598462-48598484 ACCCCGTAGGGACCCCAGCACGG + Intronic
1195548343 X:106138593-106138615 CCTCTCCAGGGACCCCAGCCTGG + Intergenic
1196574898 X:117305675-117305697 CCACTGCAGGTACCCAAACAAGG + Intergenic
1199791204 X:151156843-151156865 CCTCTGGAGGGACCCCAAATGGG + Intergenic
1200700681 Y:6399833-6399855 ATTCTGCAGGAATCCCAACCTGG + Intergenic
1200911177 Y:8532641-8532663 ATTCTGCAGGAAGCCCCACATGG - Intergenic
1201033431 Y:9764865-9764887 ATTCTGCAGGAATCCCAACCTGG - Intergenic
1202160347 Y:21927818-21927840 ACCCTGCAGGGTCCCCTGCAGGG - Intergenic
1202179554 Y:22128029-22128051 ATTCTGCAGGAATCCCAACTTGG + Intergenic
1202211807 Y:22458365-22458387 ATTCTGCAGGAATCCCAACTTGG - Intergenic
1202231009 Y:22658560-22658582 ACCCTGCAGGGTCCCCTGCAGGG + Intergenic
1202312149 Y:23537605-23537627 ACCCTGCAGGGTCCCCTGCAGGG - Intergenic
1202558654 Y:26132989-26133011 ACCCTGCAGGGTCCCCTGCAGGG + Intergenic