ID: 1061794602

View in Genome Browser
Species Human (GRCh38)
Location 9:133078649-133078671
Sequence GCCTCACGAGTGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061794601_1061794602 -5 Left 1061794601 9:133078631-133078653 CCGTGCGTTGACTGGTCAGCCTC 0: 1
1: 2
2: 9
3: 33
4: 160
Right 1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG No data
1061794599_1061794602 8 Left 1061794599 9:133078618-133078640 CCTTAAGCTTCAGCCGTGCGTTG 0: 1
1: 1
2: 7
3: 33
4: 88
Right 1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061794602 Original CRISPR GCCTCACGAGTGACCAGAGC AGG Intronic
No off target data available for this crispr