ID: 1061796106

View in Genome Browser
Species Human (GRCh38)
Location 9:133086777-133086799
Sequence ACTCTGCAGGGACCCCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796100_1061796106 -3 Left 1061796100 9:133086757-133086779 CCCCTGCACAGCCTCTTCTCACT 0: 2
1: 0
2: 6
3: 63
4: 544
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796102_1061796106 -5 Left 1061796102 9:133086759-133086781 CCTGCACAGCCTCTTCTCACTCT 0: 2
1: 0
2: 2
3: 42
4: 460
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796101_1061796106 -4 Left 1061796101 9:133086758-133086780 CCCTGCACAGCCTCTTCTCACTC 0: 2
1: 0
2: 4
3: 89
4: 1212
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796093_1061796106 15 Left 1061796093 9:133086739-133086761 CCCCCTGGGAGTCCCCAGCCCCT 0: 2
1: 1
2: 5
3: 67
4: 549
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796094_1061796106 14 Left 1061796094 9:133086740-133086762 CCCCTGGGAGTCCCCAGCCCCTG 0: 2
1: 0
2: 8
3: 72
4: 477
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796095_1061796106 13 Left 1061796095 9:133086741-133086763 CCCTGGGAGTCCCCAGCCCCTGC 0: 2
1: 1
2: 7
3: 55
4: 570
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796097_1061796106 3 Left 1061796097 9:133086751-133086773 CCCCAGCCCCTGCACAGCCTCTT 0: 2
1: 2
2: 2
3: 95
4: 733
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796096_1061796106 12 Left 1061796096 9:133086742-133086764 CCTGGGAGTCCCCAGCCCCTGCA 0: 2
1: 0
2: 7
3: 57
4: 583
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796099_1061796106 1 Left 1061796099 9:133086753-133086775 CCAGCCCCTGCACAGCCTCTTCT 0: 2
1: 1
2: 7
3: 77
4: 771
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data
1061796098_1061796106 2 Left 1061796098 9:133086752-133086774 CCCAGCCCCTGCACAGCCTCTTC 0: 2
1: 1
2: 5
3: 79
4: 644
Right 1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796106 Original CRISPR ACTCTGCAGGGACCCCAACA TGG Intronic
No off target data available for this crispr