ID: 1061796222

View in Genome Browser
Species Human (GRCh38)
Location 9:133087287-133087309
Sequence GCCGAGAGGGTGCAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796218_1061796222 -8 Left 1061796218 9:133087272-133087294 CCTTGGTCTCAAGAGGCCGAGAG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1061796222 9:133087287-133087309 GCCGAGAGGGTGCAACCCCAGGG 0: 1
1: 0
2: 1
3: 4
4: 126
1061796216_1061796222 -1 Left 1061796216 9:133087265-133087287 CCATCAGCCTTGGTCTCAAGAGG 0: 1
1: 0
2: 1
3: 26
4: 350
Right 1061796222 9:133087287-133087309 GCCGAGAGGGTGCAACCCCAGGG 0: 1
1: 0
2: 1
3: 4
4: 126
1061796215_1061796222 0 Left 1061796215 9:133087264-133087286 CCCATCAGCCTTGGTCTCAAGAG 0: 1
1: 0
2: 2
3: 7
4: 117
Right 1061796222 9:133087287-133087309 GCCGAGAGGGTGCAACCCCAGGG 0: 1
1: 0
2: 1
3: 4
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796222 Original CRISPR GCCGAGAGGGTGCAACCCCA GGG Intronic
900818660 1:4869731-4869753 GCTGAGATGGTGCAACCCTGGGG + Intergenic
903780693 1:25818278-25818300 CCCAAGAGGGAGCCACCCCATGG - Intronic
905684768 1:39900896-39900918 TCCAAGAGGGGGCCACCCCATGG - Intronic
908408040 1:63834142-63834164 ACCGAGAGGGTCTAAGCCCAGGG - Intronic
910714826 1:90219475-90219497 GCTCAGAGGGTCCTACCCCACGG - Intergenic
914508618 1:148310404-148310426 GCCGAGAGGCTCCAAGCCAAGGG + Intergenic
916812961 1:168321657-168321679 GCCAACATGGTGAAACCCCATGG - Intergenic
919738155 1:200966398-200966420 GCAGAGAGACTCCAACCCCACGG + Intergenic
922721723 1:227903240-227903262 GCCAAGAAGGTGCAGCCCCACGG + Intergenic
1063225241 10:4009517-4009539 GCCAACATGGTGAAACCCCACGG - Intergenic
1065638201 10:27752752-27752774 GCCTAGAGGCTGCCACACCAGGG + Intergenic
1065724977 10:28660619-28660641 GCCCAGAGGGTGGGGCCCCAGGG + Intergenic
1066703685 10:38156491-38156513 GCCCGGAGGGTGGGACCCCAGGG + Intergenic
1073044528 10:100628920-100628942 GCCCAGAGTCTGCAACTCCAGGG - Intergenic
1074208182 10:111302462-111302484 GCAAAGAGGGGGCAACCACATGG - Intergenic
1075973755 10:126676821-126676843 GCTCAGAGGGTCCTACCCCACGG + Intergenic
1077214302 11:1389032-1389054 GCAGAGATTGTGCACCCCCAGGG - Intergenic
1080093645 11:28378311-28378333 GCTCAGAGGGTCCTACCCCACGG - Intergenic
1081427437 11:42940682-42940704 GCTCAGAGGGTCCTACCCCAGGG + Intergenic
1081699707 11:45145499-45145521 CCCCAGAGGGTACTACCCCAGGG - Intronic
1084007488 11:66331086-66331108 GCCGAGAGGGTGACCACCCAGGG - Intronic
1084701318 11:70787984-70788006 GGTGAGAGGATGCAACCACAGGG + Intronic
1091503870 12:1046828-1046850 GCCTAGATGGTGCCACTCCACGG + Intronic
1094515705 12:31123986-31124008 GCAGAAAGGGTACACCCCCATGG - Intergenic
1097108328 12:56638706-56638728 GCCAACATGGTGAAACCCCATGG + Intronic
1101552597 12:105776416-105776438 GCTCAGAGGGTCCTACCCCACGG + Intergenic
1103978075 12:124716811-124716833 ACTGAGAGGGTGCAAACACAGGG + Intergenic
1104782595 12:131431407-131431429 GCAGAGAGGGTGCAGTCCCAAGG - Intergenic
1104879356 12:132059377-132059399 CCCGAGAGGTTGAAACCACAGGG + Intronic
1105208344 13:18241960-18241982 GCCAAGATGGTGAAACACCAGGG - Intergenic
1106658635 13:31775116-31775138 GCCCAGTGTGTGCAACACCAGGG - Intronic
1106950107 13:34874035-34874057 GCAAAGAGGGTGCAACACCAGGG - Intergenic
1110152782 13:72275066-72275088 GCTGAGATGGTGTAACCACAAGG + Intergenic
1111430649 13:88145053-88145075 GCTGTGAGGCTGCGACCCCACGG - Intergenic
1111812744 13:93111871-93111893 GCAGACATGGTGAAACCCCATGG - Intergenic
1115972944 14:38966382-38966404 GCCAACATGGTGAAACCCCAAGG + Intergenic
1116339063 14:43698992-43699014 GCTCAGAGGGTCCTACCCCACGG + Intergenic
1117804691 14:59479652-59479674 GCCGAGAGAGGGAAACCCAAGGG + Intronic
1118751170 14:68808750-68808772 TCCCAGTGGGTGCAACTCCATGG + Intergenic
1121730894 14:96186289-96186311 GCCCAGAGGCTGCTAACCCAGGG - Intergenic
1124563390 15:30794863-30794885 CCCGAGAGGCAACAACCCCAGGG - Intergenic
1127774999 15:62257546-62257568 GGCAAGAGGCTGCAGCCCCAGGG - Intergenic
1129091164 15:73152431-73152453 TCCTAGAGGGTGGTACCCCAGGG + Intronic
1131441823 15:92465275-92465297 ACCCAGAGGGTGAAATCCCAGGG - Exonic
1132433486 15:101778839-101778861 CCCGAGAGGCAACAACCCCAGGG + Intergenic
1133218887 16:4309858-4309880 GCCCAGGAGGTGCAGCCCCAGGG - Intergenic
1133560995 16:6950143-6950165 GCCAACATGGTGAAACCCCATGG - Intronic
1138297206 16:55897175-55897197 GCCAAGAGCATCCAACCCCAGGG + Intronic
1139705356 16:68737422-68737444 GCCGAGAGGCTGCGGCTCCAAGG - Exonic
1142272703 16:89099022-89099044 GCCCAGAGGGTGCTTCCCCCAGG + Intronic
1147464282 17:40598716-40598738 GCAGAGAGAGTGCAAACACATGG + Intergenic
1148100559 17:45088075-45088097 GCTGAGGAGGTGCATCCCCACGG + Intronic
1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG + Intronic
1153284255 18:3443718-3443740 GCCAACATGGTGAAACCCCATGG - Intronic
1159334812 18:67048467-67048489 GCCAACATGGTGAAACCCCATGG - Intergenic
1160497419 18:79383565-79383587 GAGGAGAGGCTGCAGCCCCACGG - Intergenic
1161121430 19:2529005-2529027 GGCGACAGGGTGCAAGTCCACGG - Intronic
1162477915 19:10911971-10911993 GCCGAGCGGGAGCTTCCCCAGGG + Intronic
930031728 2:47062194-47062216 GCCGAGAGAATGCAACGTCATGG + Intronic
934460514 2:94211899-94211921 ACCTAGAGCGTGCAACACCACGG + Intergenic
939838588 2:147158829-147158851 CCCAAGAGGGTGCAACCCCAGGG - Intergenic
940804519 2:158171204-158171226 GCACAGAGGCTGCAACCCCTGGG + Exonic
941292634 2:163695918-163695940 GCCAATATGGTGAAACCCCAGGG + Intronic
943125280 2:183788975-183788997 GCTCAGAGGGTCCCACCCCACGG + Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
946171009 2:217895585-217895607 ACAGAGAGGTTGCAACCTCATGG - Intronic
948079690 2:235195652-235195674 GCAGAGAGGGTGCAACAGAATGG - Intergenic
948088011 2:235266890-235266912 GCAGAGGGGGTGCAAACCCCAGG - Intergenic
1175545027 20:59772666-59772688 GCCGAGTGGGGCCACCCCCAGGG + Intronic
1176168095 20:63685073-63685095 GGCAACATGGTGCAACCCCAGGG - Intronic
1181520108 22:23442483-23442505 GCCAACATGGTGAAACCCCATGG - Intergenic
952889377 3:38030296-38030318 GCCGAGGGGGAGGATCCCCAGGG + Intergenic
954246105 3:49332659-49332681 GCCAACATGGTGAAACCCCATGG + Intronic
954972640 3:54664105-54664127 GCAAAGAGGTTGCATCCCCAAGG + Intronic
955270691 3:57495369-57495391 GCCAACAGGTTGAAACCCCATGG + Intronic
955339515 3:58114321-58114343 GCCAACATGGTGAAACCCCATGG - Intronic
958880319 3:99662189-99662211 GCCAACATGGTGAAACCCCATGG + Intronic
959607492 3:108258028-108258050 GCTCAGAGGGTCCTACCCCACGG + Intergenic
964421723 3:156510771-156510793 GCCCACAGGGTGGAACGCCATGG - Intronic
968378075 4:61321-61343 GCCGACATGGTGAAACCCCGTGG - Intronic
968452803 4:683126-683148 GACCACATGGTGCAACCCCAGGG + Intronic
969111360 4:4846267-4846289 GTGGAGAGGGGGCAATCCCAGGG + Intergenic
977157752 4:93594709-93594731 GCTCAGAGGGTCCTACCCCACGG - Intronic
978216668 4:106213704-106213726 GCTCAGAGGGTCCTACCCCACGG + Intronic
979440166 4:120741764-120741786 GCTCAGAGGGTCCTACCCCACGG + Intronic
979632944 4:122923334-122923356 GCCGAGGGGGCGCAACCTGAGGG + Intronic
984063443 4:175020089-175020111 GCTCAGAGGGTCCTACCCCACGG + Intergenic
985627732 5:998579-998601 CCCGTGAGGGTGCCACTCCATGG + Intergenic
990783622 5:59395067-59395089 GCTGGGAGGGTCCTACCCCACGG + Intronic
996591473 5:125152812-125152834 TCCGAGATGGACCAACCCCAGGG - Intergenic
997260923 5:132465008-132465030 TACGAGAGGGTGCAACTTCAGGG - Exonic
998991977 5:147827230-147827252 GCCAACATGGTGAAACCCCATGG - Intronic
1000771260 5:165357887-165357909 GCCAACATGGTGAAACCCCATGG - Intergenic
1007406158 6:41637481-41637503 GCCGAGACGCTGTCACCCCAGGG + Intronic
1013944313 6:115704085-115704107 GCCTAGAGTGTGCATCCACAGGG + Intergenic
1018847753 6:167567056-167567078 GCCCAGAGGATGGAGCCCCACGG + Intergenic
1019289061 7:241132-241154 GCAGGGAGGGAGCAGCCCCAGGG - Intronic
1019519021 7:1452313-1452335 CCCGAGAGGGTGTGACCCGAGGG + Intronic
1020454102 7:8352082-8352104 GCTCAGAGGGTCCTACCCCACGG + Intergenic
1022845480 7:34205897-34205919 GCTCAGAGGGTCCTACCCCACGG - Intergenic
1035586464 8:778996-779018 GCTCAGAGGGTCCTACCCCACGG - Intergenic
1035792825 8:2323368-2323390 GCTCAGAGGGTCCTACCCCACGG - Intergenic
1035799979 8:2398337-2398359 GCTCAGAGGGTCCTACCCCACGG + Intergenic
1041062764 8:54052036-54052058 GCCAACATGGTGAAACCCCATGG - Intronic
1041117138 8:54550826-54550848 CCTGAGAGGAAGCAACCCCAGGG + Intergenic
1042252963 8:66775052-66775074 GCCGGTGGGGTGCAGCCCCAGGG - Intronic
1047779307 8:128098481-128098503 GCCGAGAGGCCGCAACCGGATGG - Intergenic
1048596935 8:135876212-135876234 GCTCAGAGGGTCCTACCCCACGG + Intergenic
1048778060 8:137969456-137969478 GAAGAGAGGGTGCAAATCCAAGG - Intergenic
1048792493 8:138116513-138116535 GCTGGGAGGGTCCTACCCCACGG + Intergenic
1049252230 8:141595456-141595478 GCCTACAGGATGGAACCCCAGGG - Intergenic
1053549035 9:39055641-39055663 GCTAAGAGGGAGCAACCTCAGGG + Intergenic
1053813161 9:41875725-41875747 GCTAAGAGGGAGCAACCTCAGGG + Intergenic
1054617434 9:67311714-67311736 GCTAAGAGGGAGCAACCTCAGGG - Intergenic
1055761603 9:79614688-79614710 GCCAAGCTTGTGCAACCCCAGGG + Intronic
1056191394 9:84187854-84187876 GCCCAGAGGGTTCCACTCCATGG + Intergenic
1059308605 9:113373605-113373627 GCCTAGAGGGCTCAACTCCAGGG - Exonic
1059918996 9:119136765-119136787 GCCATGAGGGTCCAACCTCATGG + Intergenic
1061063430 9:128262541-128262563 GGCAAGAGGCTGCAGCCCCATGG - Exonic
1061796222 9:133087287-133087309 GCCGAGAGGGTGCAACCCCAGGG + Intronic
1062209111 9:135353663-135353685 GGATAGAGGGTGGAACCCCAGGG + Intergenic
1203394742 Un_KI270512v1:15087-15109 GCTCAGAGGGTCCTACCCCATGG - Intergenic
1203571164 Un_KI270744v1:132928-132950 GCCAACATGGTGAAACCCCATGG + Intergenic
1185603905 X:1355987-1356009 GCTCCGAGGGTGCAACCCCAAGG + Intronic
1185847259 X:3449400-3449422 GCCGAGAGGGCCCTACCCAAGGG - Intergenic
1194079170 X:89436521-89436543 GCCAACATGGTGAAACCCCATGG + Intergenic
1196857022 X:119993896-119993918 GCCAACATGGTGAAACCCCATGG + Intergenic
1196982369 X:121228956-121228978 GCCAAGATGGTGAAACCCCCAGG - Intergenic
1198271038 X:135056188-135056210 GCTGTGGGGGTCCAACCCCATGG - Intergenic
1200431791 Y:3091837-3091859 GCCAACATGGTGAAACCCCATGG + Intergenic
1200914898 Y:8562984-8563006 CCTGAGACAGTGCAACCCCAGGG - Intergenic
1200964722 Y:9025641-9025663 TCCGGGAGAGAGCAACCCCAAGG + Intergenic