ID: 1061796288

View in Genome Browser
Species Human (GRCh38)
Location 9:133087576-133087598
Sequence ATTCAGGGAAGGGCAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796288_1061796298 2 Left 1061796288 9:133087576-133087598 CCAGAGCCTGCCCTTCCCTGAAT No data
Right 1061796298 9:133087601-133087623 AACCAGGCTGCTGGCTCCCAGGG No data
1061796288_1061796304 27 Left 1061796288 9:133087576-133087598 CCAGAGCCTGCCCTTCCCTGAAT No data
Right 1061796304 9:133087626-133087648 TAGATTCTGTCCCATATGGTGGG No data
1061796288_1061796303 26 Left 1061796288 9:133087576-133087598 CCAGAGCCTGCCCTTCCCTGAAT No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796288_1061796305 30 Left 1061796288 9:133087576-133087598 CCAGAGCCTGCCCTTCCCTGAAT No data
Right 1061796305 9:133087629-133087651 ATTCTGTCCCATATGGTGGGAGG No data
1061796288_1061796297 1 Left 1061796288 9:133087576-133087598 CCAGAGCCTGCCCTTCCCTGAAT No data
Right 1061796297 9:133087600-133087622 GAACCAGGCTGCTGGCTCCCAGG No data
1061796288_1061796302 23 Left 1061796288 9:133087576-133087598 CCAGAGCCTGCCCTTCCCTGAAT No data
Right 1061796302 9:133087622-133087644 GGACTAGATTCTGTCCCATATGG No data
1061796288_1061796296 -7 Left 1061796288 9:133087576-133087598 CCAGAGCCTGCCCTTCCCTGAAT No data
Right 1061796296 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796288 Original CRISPR ATTCAGGGAAGGGCAGGCTC TGG (reversed) Intergenic
No off target data available for this crispr