ID: 1061796292

View in Genome Browser
Species Human (GRCh38)
Location 9:133087586-133087608
Sequence GCCTGGTTCCATTCAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796292_1061796305 20 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796305 9:133087629-133087651 ATTCTGTCCCATATGGTGGGAGG No data
1061796292_1061796307 22 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796307 9:133087631-133087653 TCTGTCCCATATGGTGGGAGGGG No data
1061796292_1061796303 16 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796292_1061796306 21 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796292_1061796311 29 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796311 9:133087638-133087660 CATATGGTGGGAGGGGCTGGTGG No data
1061796292_1061796298 -8 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796298 9:133087601-133087623 AACCAGGCTGCTGGCTCCCAGGG No data
1061796292_1061796297 -9 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796297 9:133087600-133087622 GAACCAGGCTGCTGGCTCCCAGG No data
1061796292_1061796302 13 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796302 9:133087622-133087644 GGACTAGATTCTGTCCCATATGG No data
1061796292_1061796308 26 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796308 9:133087635-133087657 TCCCATATGGTGGGAGGGGCTGG No data
1061796292_1061796304 17 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796304 9:133087626-133087648 TAGATTCTGTCCCATATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796292 Original CRISPR GCCTGGTTCCATTCAGGGAA GGG (reversed) Intergenic
No off target data available for this crispr