ID: 1061796293

View in Genome Browser
Species Human (GRCh38)
Location 9:133087587-133087609
Sequence AGCCTGGTTCCATTCAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796293_1061796298 -9 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796298 9:133087601-133087623 AACCAGGCTGCTGGCTCCCAGGG No data
1061796293_1061796305 19 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796305 9:133087629-133087651 ATTCTGTCCCATATGGTGGGAGG No data
1061796293_1061796307 21 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796307 9:133087631-133087653 TCTGTCCCATATGGTGGGAGGGG No data
1061796293_1061796302 12 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796302 9:133087622-133087644 GGACTAGATTCTGTCCCATATGG No data
1061796293_1061796306 20 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796293_1061796297 -10 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796297 9:133087600-133087622 GAACCAGGCTGCTGGCTCCCAGG No data
1061796293_1061796308 25 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796308 9:133087635-133087657 TCCCATATGGTGGGAGGGGCTGG No data
1061796293_1061796303 15 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796293_1061796304 16 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796304 9:133087626-133087648 TAGATTCTGTCCCATATGGTGGG No data
1061796293_1061796311 28 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796311 9:133087638-133087660 CATATGGTGGGAGGGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796293 Original CRISPR AGCCTGGTTCCATTCAGGGA AGG (reversed) Intergenic
No off target data available for this crispr