ID: 1061796294

View in Genome Browser
Species Human (GRCh38)
Location 9:133087591-133087613
Sequence CAGCAGCCTGGTTCCATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796294_1061796302 8 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796302 9:133087622-133087644 GGACTAGATTCTGTCCCATATGG No data
1061796294_1061796308 21 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796308 9:133087635-133087657 TCCCATATGGTGGGAGGGGCTGG No data
1061796294_1061796307 17 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796307 9:133087631-133087653 TCTGTCCCATATGGTGGGAGGGG No data
1061796294_1061796303 11 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796294_1061796304 12 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796304 9:133087626-133087648 TAGATTCTGTCCCATATGGTGGG No data
1061796294_1061796311 24 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796311 9:133087638-133087660 CATATGGTGGGAGGGGCTGGTGG No data
1061796294_1061796306 16 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796294_1061796305 15 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796305 9:133087629-133087651 ATTCTGTCCCATATGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796294 Original CRISPR CAGCAGCCTGGTTCCATTCA GGG (reversed) Intergenic