ID: 1061796295

View in Genome Browser
Species Human (GRCh38)
Location 9:133087592-133087614
Sequence CCAGCAGCCTGGTTCCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796295_1061796302 7 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796302 9:133087622-133087644 GGACTAGATTCTGTCCCATATGG No data
1061796295_1061796303 10 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796295_1061796305 14 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796305 9:133087629-133087651 ATTCTGTCCCATATGGTGGGAGG No data
1061796295_1061796304 11 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796304 9:133087626-133087648 TAGATTCTGTCCCATATGGTGGG No data
1061796295_1061796306 15 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796295_1061796311 23 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796311 9:133087638-133087660 CATATGGTGGGAGGGGCTGGTGG No data
1061796295_1061796307 16 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796307 9:133087631-133087653 TCTGTCCCATATGGTGGGAGGGG No data
1061796295_1061796308 20 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796308 9:133087635-133087657 TCCCATATGGTGGGAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796295 Original CRISPR CCAGCAGCCTGGTTCCATTC AGG (reversed) Intergenic
No off target data available for this crispr