ID: 1061796300

View in Genome Browser
Species Human (GRCh38)
Location 9:133087617-133087639
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796300_1061796313 17 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796313 9:133087657-133087679 GTGGCAGCTGCAGTCAGAGAGGG No data
1061796300_1061796311 -2 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796311 9:133087638-133087660 CATATGGTGGGAGGGGCTGGTGG No data
1061796300_1061796315 24 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG No data
1061796300_1061796308 -5 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796308 9:133087635-133087657 TCCCATATGGTGGGAGGGGCTGG No data
1061796300_1061796316 25 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796316 9:133087665-133087687 TGCAGTCAGAGAGGGAGCTGGGG No data
1061796300_1061796306 -10 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796300_1061796317 30 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796317 9:133087670-133087692 TCAGAGAGGGAGCTGGGGTCTGG No data
1061796300_1061796307 -9 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796307 9:133087631-133087653 TCTGTCCCATATGGTGGGAGGGG No data
1061796300_1061796314 23 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796314 9:133087663-133087685 GCTGCAGTCAGAGAGGGAGCTGG No data
1061796300_1061796312 16 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796312 9:133087656-133087678 GGTGGCAGCTGCAGTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796300 Original CRISPR TGGGACAGAATCTAGTCCCT GGG (reversed) Intergenic