ID: 1061796303

View in Genome Browser
Species Human (GRCh38)
Location 9:133087625-133087647
Sequence CTAGATTCTGTCCCATATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796292_1061796303 16 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796290_1061796303 20 Left 1061796290 9:133087582-133087604 CCTGCCCTTCCCTGAATGGAACC No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796295_1061796303 10 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796293_1061796303 15 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796299_1061796303 -1 Left 1061796299 9:133087603-133087625 CCAGGCTGCTGGCTCCCAGGGAC No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796294_1061796303 11 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data
1061796288_1061796303 26 Left 1061796288 9:133087576-133087598 CCAGAGCCTGCCCTTCCCTGAAT No data
Right 1061796303 9:133087625-133087647 CTAGATTCTGTCCCATATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796303 Original CRISPR CTAGATTCTGTCCCATATGG TGG Intergenic
No off target data available for this crispr