ID: 1061796306

View in Genome Browser
Species Human (GRCh38)
Location 9:133087630-133087652
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796299_1061796306 4 Left 1061796299 9:133087603-133087625 CCAGGCTGCTGGCTCCCAGGGAC No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796293_1061796306 20 Left 1061796293 9:133087587-133087609 CCTTCCCTGAATGGAACCAGGCT No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796295_1061796306 15 Left 1061796295 9:133087592-133087614 CCTGAATGGAACCAGGCTGCTGG No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796292_1061796306 21 Left 1061796292 9:133087586-133087608 CCCTTCCCTGAATGGAACCAGGC No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796290_1061796306 25 Left 1061796290 9:133087582-133087604 CCTGCCCTTCCCTGAATGGAACC No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796300_1061796306 -10 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data
1061796294_1061796306 16 Left 1061796294 9:133087591-133087613 CCCTGAATGGAACCAGGCTGCTG No data
Right 1061796306 9:133087630-133087652 TTCTGTCCCATATGGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796306 Original CRISPR TTCTGTCCCATATGGTGGGA GGG Intergenic