ID: 1061796310

View in Genome Browser
Species Human (GRCh38)
Location 9:133087637-133087659
Sequence CACCAGCCCCTCCCACCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796310_1061796319 20 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796319 9:133087680-133087702 AGCTGGGGTCTGGCAGGCTGTGG No data
1061796310_1061796314 3 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796314 9:133087663-133087685 GCTGCAGTCAGAGAGGGAGCTGG No data
1061796310_1061796315 4 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG No data
1061796310_1061796320 30 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796320 9:133087690-133087712 TGGCAGGCTGTGGCTGCCTCTGG No data
1061796310_1061796318 14 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796318 9:133087674-133087696 AGAGGGAGCTGGGGTCTGGCAGG No data
1061796310_1061796317 10 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796317 9:133087670-133087692 TCAGAGAGGGAGCTGGGGTCTGG No data
1061796310_1061796312 -4 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796312 9:133087656-133087678 GGTGGCAGCTGCAGTCAGAGAGG No data
1061796310_1061796313 -3 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796313 9:133087657-133087679 GTGGCAGCTGCAGTCAGAGAGGG No data
1061796310_1061796316 5 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796316 9:133087665-133087687 TGCAGTCAGAGAGGGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796310 Original CRISPR CACCAGCCCCTCCCACCATA TGG (reversed) Intergenic
No off target data available for this crispr