ID: 1061796312

View in Genome Browser
Species Human (GRCh38)
Location 9:133087656-133087678
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796309_1061796312 -3 Left 1061796309 9:133087636-133087658 CCCATATGGTGGGAGGGGCTGGT No data
Right 1061796312 9:133087656-133087678 GGTGGCAGCTGCAGTCAGAGAGG No data
1061796299_1061796312 30 Left 1061796299 9:133087603-133087625 CCAGGCTGCTGGCTCCCAGGGAC No data
Right 1061796312 9:133087656-133087678 GGTGGCAGCTGCAGTCAGAGAGG No data
1061796300_1061796312 16 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796312 9:133087656-133087678 GGTGGCAGCTGCAGTCAGAGAGG No data
1061796301_1061796312 15 Left 1061796301 9:133087618-133087640 CCAGGGACTAGATTCTGTCCCAT No data
Right 1061796312 9:133087656-133087678 GGTGGCAGCTGCAGTCAGAGAGG No data
1061796310_1061796312 -4 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796312 9:133087656-133087678 GGTGGCAGCTGCAGTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796312 Original CRISPR GGTGGCAGCTGCAGTCAGAG AGG Intergenic