ID: 1061796314

View in Genome Browser
Species Human (GRCh38)
Location 9:133087663-133087685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796300_1061796314 23 Left 1061796300 9:133087617-133087639 CCCAGGGACTAGATTCTGTCCCA No data
Right 1061796314 9:133087663-133087685 GCTGCAGTCAGAGAGGGAGCTGG No data
1061796301_1061796314 22 Left 1061796301 9:133087618-133087640 CCAGGGACTAGATTCTGTCCCAT No data
Right 1061796314 9:133087663-133087685 GCTGCAGTCAGAGAGGGAGCTGG No data
1061796309_1061796314 4 Left 1061796309 9:133087636-133087658 CCCATATGGTGGGAGGGGCTGGT No data
Right 1061796314 9:133087663-133087685 GCTGCAGTCAGAGAGGGAGCTGG No data
1061796310_1061796314 3 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796314 9:133087663-133087685 GCTGCAGTCAGAGAGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796314 Original CRISPR GCTGCAGTCAGAGAGGGAGC TGG Intergenic