ID: 1061796318

View in Genome Browser
Species Human (GRCh38)
Location 9:133087674-133087696
Sequence AGAGGGAGCTGGGGTCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796310_1061796318 14 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796318 9:133087674-133087696 AGAGGGAGCTGGGGTCTGGCAGG No data
1061796309_1061796318 15 Left 1061796309 9:133087636-133087658 CCCATATGGTGGGAGGGGCTGGT No data
Right 1061796318 9:133087674-133087696 AGAGGGAGCTGGGGTCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796318 Original CRISPR AGAGGGAGCTGGGGTCTGGC AGG Intergenic