ID: 1061796320

View in Genome Browser
Species Human (GRCh38)
Location 9:133087690-133087712
Sequence TGGCAGGCTGTGGCTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061796310_1061796320 30 Left 1061796310 9:133087637-133087659 CCATATGGTGGGAGGGGCTGGTG No data
Right 1061796320 9:133087690-133087712 TGGCAGGCTGTGGCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061796320 Original CRISPR TGGCAGGCTGTGGCTGCCTC TGG Intergenic