ID: 1061798259

View in Genome Browser
Species Human (GRCh38)
Location 9:133100933-133100955
Sequence CTGTACCCCAGCCCTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061798259_1061798271 23 Left 1061798259 9:133100933-133100955 CCTGACCCAGGGCTGGGGTACAG 0: 1
1: 0
2: 1
3: 37
4: 377
Right 1061798271 9:133100979-133101001 ATCTGTCGCAGGACACCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 89
1061798259_1061798270 20 Left 1061798259 9:133100933-133100955 CCTGACCCAGGGCTGGGGTACAG 0: 1
1: 0
2: 1
3: 37
4: 377
Right 1061798270 9:133100976-133100998 TTCATCTGTCGCAGGACACCTGG 0: 1
1: 0
2: 5
3: 65
4: 491
1061798259_1061798269 12 Left 1061798259 9:133100933-133100955 CCTGACCCAGGGCTGGGGTACAG 0: 1
1: 0
2: 1
3: 37
4: 377
Right 1061798269 9:133100968-133100990 ACAAATGGTTCATCTGTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 63
1061798259_1061798268 -3 Left 1061798259 9:133100933-133100955 CCTGACCCAGGGCTGGGGTACAG 0: 1
1: 0
2: 1
3: 37
4: 377
Right 1061798268 9:133100953-133100975 CAGAGGGTGGGGGTTACAAATGG 0: 1
1: 0
2: 1
3: 24
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061798259 Original CRISPR CTGTACCCCAGCCCTGGGTC AGG (reversed) Intronic
900495325 1:2973486-2973508 CTGAACCACTGCCCTGGGCCGGG - Intergenic
900596753 1:3483446-3483468 ATGAACCCCAGCCCTCGGCCTGG - Intergenic
900717300 1:4153225-4153247 CTGATGCCCAGCCCTGGGGCAGG - Intergenic
900788348 1:4663703-4663725 CTTTTCCCCACCCCTAGGTCTGG - Intronic
901012174 1:6208138-6208160 TGGAATCCCAGCCCTGGGTCTGG + Intronic
901760594 1:11468840-11468862 CCGTACCCCAGCCCTGGCCTGGG + Intergenic
902701974 1:18178759-18178781 CCCTACCCCACCCCAGGGTCTGG + Intronic
902906764 1:19563984-19564006 CTGGTCTCCAGCCCTGGATCTGG + Intergenic
902934468 1:19754828-19754850 CTGTGTGCCAGCCCTGGGCCGGG + Intronic
903103035 1:21049852-21049874 CTGTACCCCAGCCTTGGCCACGG + Intronic
903650818 1:24921065-24921087 CTGTACCCCAGGGCTGGCACAGG + Intronic
903793998 1:25914496-25914518 CTATACTCCTGCCCTGGGTCTGG + Intergenic
904038606 1:27571689-27571711 CTTCACCCAAGCCCTGGGGCTGG + Intronic
904398829 1:30242210-30242232 CTGTGCACCAGCACTGTGTCAGG - Intergenic
904835483 1:33332850-33332872 CTGTACCTCTGGCTTGGGTCAGG - Intronic
904998161 1:34647494-34647516 CTTTACCCCATCCCTGGGCAGGG + Intergenic
906143964 1:43549239-43549261 CTGAACACCAGCTGTGGGTCAGG + Intronic
906202848 1:43971173-43971195 CTGTGCCCATGCCCTGGGTAAGG + Exonic
907131432 1:52100762-52100784 TTGTACAACAGACCTGGGTCAGG + Intergenic
909529864 1:76670426-76670448 CAGCACCCCTGTCCTGGGTCAGG + Intergenic
910606690 1:89093131-89093153 CTGTACTCCAGCCGTGGGAATGG - Intergenic
911043151 1:93607774-93607796 CTTTAACCCAGCCCTGGATCAGG - Intronic
911935263 1:103961190-103961212 CTGCAGCCCAGCCATGGCTCTGG - Intergenic
912559749 1:110542014-110542036 CTGTTCCTCAGTCCTGGGTTTGG + Intergenic
912747100 1:112253998-112254020 CTCTTCCCCAGTCCTGTGTCTGG + Intergenic
914422168 1:147539291-147539313 CTGTACCCCAGGGTTGGGTTTGG - Intergenic
915699163 1:157774307-157774329 CTGAACCCCAGTCTTGGCTCTGG - Intronic
916094736 1:161339217-161339239 CTGTACTCCAGCCCGGGTTGGGG - Intronic
916996542 1:170307652-170307674 ATGTTCCCCAGCTCTGAGTCAGG - Intergenic
917854459 1:179089692-179089714 CTCCACCTGAGCCCTGGGTCGGG + Intronic
917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG + Intronic
919789897 1:201284224-201284246 CTGTCCCTGAGCCCTGGGTCTGG + Intronic
921319628 1:213926027-213926049 CTGTATTCCAGACCTGGTTCTGG + Intergenic
921545782 1:216473315-216473337 CTCTAGCCTAGCCCTGGGCCTGG + Intergenic
922348189 1:224714612-224714634 CAGTACCAGAGCCCTGGGCCTGG - Intronic
922776070 1:228214730-228214752 CTCTTCCTGAGCCCTGGGTCTGG - Intronic
1063016397 10:2081819-2081841 CTGTTCCCCAGGCCAGGCTCAGG - Intergenic
1064251743 10:13711173-13711195 CTGCACCCCGGCCCTGGGCAAGG - Intronic
1064499205 10:15950615-15950637 CTGTATTCGAGCCCTGGGTAAGG + Intergenic
1065352498 10:24807967-24807989 CTGTACTCCAGCCTAGGGGCAGG + Intergenic
1065767448 10:29043927-29043949 CTGCACCCCAGCCTTGGGAACGG - Intergenic
1066178836 10:32939874-32939896 CTGCACAGCTGCCCTGGGTCAGG + Intronic
1066433057 10:35371184-35371206 CTGTATCCCAGCACTGGGCTGGG - Intronic
1067694651 10:48526049-48526071 CTGGACCACAGCCCTGCTTCAGG - Intronic
1069594257 10:69660452-69660474 CTGTGTACCAGCCCTGCGTCGGG + Intergenic
1070461626 10:76676134-76676156 GTGTATCCCAGCCCTGGGACTGG - Intergenic
1070688537 10:78507889-78507911 CTGAACCCTAGCCCTGGGGCAGG + Intergenic
1071502007 10:86210928-86210950 CTGAACCCCAGGACTGGGACTGG + Intronic
1071636377 10:87259732-87259754 CGGTACCCAAACCTTGGGTCTGG + Intergenic
1073027412 10:100498088-100498110 CTGTACCCCCAGCCTGGGCCAGG + Exonic
1073204950 10:101763899-101763921 CTGTATCCAGGCCATGGGTCAGG - Intergenic
1073330948 10:102669522-102669544 CTGTTCCCCAGCCCAGGCCCAGG - Intergenic
1073720032 10:106157952-106157974 CAGTAAGCCAGACCTGGGTCGGG - Intergenic
1074446420 10:113524834-113524856 CTGAAGCCCAGCCCTGGCACAGG - Intergenic
1074641004 10:115380525-115380547 TTGTCCCCCAGCCCTGCCTCTGG + Intronic
1075887451 10:125913699-125913721 CTGTATACCAGCTCTGGGACTGG + Intronic
1075908895 10:126106431-126106453 CACTTCCCCTGCCCTGGGTCAGG + Intronic
1076570851 10:131432035-131432057 CTGCACCCCAGCCCTGGTCACGG + Intergenic
1076779613 10:132717005-132717027 CTGGACCTCAGCCTTGGGGCTGG - Intronic
1077088669 11:767704-767726 CTGTGCCCCTGCCCTGTGACCGG - Exonic
1077263785 11:1638583-1638605 GTGGAGCCCAGCCCAGGGTCGGG - Intergenic
1077343299 11:2035549-2035571 CTCTGCCCCAGCCCTGGCCCCGG + Intergenic
1077503384 11:2919285-2919307 CTGTTCCCCTGCCCCGGCTCAGG + Exonic
1077524630 11:3056944-3056966 CTGTGCTCCAGCCACGGGTCTGG + Intronic
1077603618 11:3591821-3591843 CTGTAACACAGCCCTGTGTTGGG + Intergenic
1077636079 11:3841669-3841691 CTGGACCTCAGGCCTGGGTGCGG - Intergenic
1077918685 11:6627089-6627111 CAGTACCCCAACCCTGGCTCTGG - Exonic
1078210171 11:9264482-9264504 TTATACCCCAGCCCTGGGCTGGG - Intronic
1078508505 11:11968760-11968782 CTGTGCTCCCGCCCTGGGTGTGG - Intronic
1078551964 11:12287377-12287399 CTCCACCCCACCCCTGGCTCAGG + Intronic
1078609848 11:12810635-12810657 CTGTGCTGCACCCCTGGGTCTGG + Intronic
1079158176 11:17968159-17968181 CTGAACACCACCTCTGGGTCAGG - Intronic
1079295007 11:19225372-19225394 TTGTCTGCCAGCCCTGGGTCTGG - Exonic
1079546073 11:21633402-21633424 CTGGACCCCAGTCATGGCTCAGG + Intergenic
1080791697 11:35527126-35527148 CTGAACTCCAGCCCTGCTTCTGG + Intronic
1081525328 11:43924323-43924345 CCGTCCCCCAGCCCTGGCCCTGG + Intergenic
1082074166 11:47963359-47963381 CTGTGTCCCTGCCCTGGGTACGG + Intergenic
1083596294 11:63919539-63919561 CTGTGCCCCAGGCCTGGGGGAGG - Intergenic
1083616448 11:64028815-64028837 CTGTACTCCAGAGCTGGGGCTGG - Intronic
1083709543 11:64539486-64539508 CTGCAGCCAGGCCCTGGGTCAGG - Intergenic
1084203636 11:67578236-67578258 CGGAGCCCCAGCCCTTGGTCAGG + Intergenic
1084231530 11:67757120-67757142 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
1084561065 11:69905699-69905721 CTCCACCCCAGGCCTGGTTCTGG + Intergenic
1084653017 11:70500070-70500092 CTCCACACCAGCCCTGGGTGGGG + Intronic
1084784259 11:71433052-71433074 CAGTACCCCAGGACAGGGTCAGG - Intronic
1084813251 11:71628834-71628856 CTGTAACACAGCCCTGTGTTGGG - Intergenic
1084980611 11:72826680-72826702 CTGTACCCCGGCCCCAGGTACGG - Intronic
1085312235 11:75523750-75523772 CTCTACCCCAGACCTCTGTCTGG - Intronic
1085390359 11:76179076-76179098 CTGTGGACCAGGCCTGGGTCGGG + Intergenic
1085531728 11:77195702-77195724 CTGTCCCAGAGCCCTGGGCCAGG + Intronic
1086337082 11:85811004-85811026 CTGGCCCCCAGCCCTCGGCCTGG + Exonic
1088250538 11:107858092-107858114 CTGGACCCCAGCCCTGGGGGTGG + Intronic
1202826285 11_KI270721v1_random:90738-90760 CTCTGCCCCAGCCCTGGCCCCGG + Intergenic
1091589922 12:1836896-1836918 CGGTGCCCCAGCCCTGGCCCTGG - Intronic
1091803019 12:3336692-3336714 CTGTTTCCCTGCCCTGGGCCTGG + Intergenic
1092055330 12:5504116-5504138 CAGAAACCCAGCCCTGGGTTGGG - Intronic
1092430831 12:8407381-8407403 CTGTAACACAGCCCTGTGTTGGG + Intergenic
1101529755 12:105563161-105563183 CTCTATCCCAACCCTGGGCCAGG + Intergenic
1101838544 12:108311786-108311808 CTGCAGCCCTGTCCTGGGTCAGG - Intronic
1102246459 12:111359563-111359585 CTGAACACCTCCCCTGGGTCCGG + Intergenic
1102260021 12:111437901-111437923 CTGAGGCCCAGCCCTGGGGCAGG - Intronic
1103012025 12:117465181-117465203 CTGTGTCCCAGCCCTGGGCCTGG - Exonic
1103322355 12:120099617-120099639 CTGTGCCCCTCCCCTGGGGCAGG + Intronic
1103719213 12:122964523-122964545 GTGGACTCCAGCCCCGGGTCGGG + Intronic
1104095476 12:125553297-125553319 CTGCAGCCCAGCCCTGGGACTGG - Intronic
1104278791 12:127354735-127354757 CTGCAGCCCAGCCTTGGGACTGG + Intergenic
1104853897 12:131893134-131893156 CTGGCCCCCAGTCCAGGGTCGGG + Intergenic
1105620453 13:22061196-22061218 TTGTTTCCCAGCCTTGGGTCAGG + Intergenic
1105948558 13:25210029-25210051 CTGTCCCTCAGGTCTGGGTCTGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107236007 13:38171576-38171598 CTGTATCCCAGCTCTGGCACTGG - Intergenic
1108228558 13:48316099-48316121 CTGCAGCTCAGCCCTGGGCCTGG - Intronic
1109718801 13:66251099-66251121 CTGTATCCCATCCCTGAGTGAGG - Intergenic
1111876980 13:93909947-93909969 CTGTACCCTGGCCCTGGGGTGGG - Intronic
1112282256 13:98073348-98073370 CTGGATCCCAGCCCTGGCTGGGG + Intergenic
1113912947 13:113852887-113852909 CTGAACCACAGCTCTGGGTGAGG - Intronic
1114044584 14:18712604-18712626 CTATAGCCCACCCGTGGGTCCGG - Intergenic
1114048918 14:18903330-18903352 CTATAGCCCACCCGTGGGTCCGG - Intergenic
1114113645 14:19498603-19498625 CTATAGCCCACCCGTGGGTCCGG + Intergenic
1114115345 14:19616352-19616374 CTATAGCCCACCCGTGGGTCCGG + Intergenic
1115963902 14:38865340-38865362 CTGAACCCCAGCCTTGGGAAAGG - Intergenic
1118310147 14:64686026-64686048 CTGTACCCGAGCTCTGGGCCTGG + Intergenic
1118316122 14:64727184-64727206 CTGTGCCCCAGCAGTGGGGCTGG + Intronic
1119201001 14:72752989-72753011 CTGCACCCCAGCCCAGGTGCAGG - Intronic
1120575580 14:86176477-86176499 CTGTACCCCAGGCATGTGTCAGG - Intergenic
1121015749 14:90547974-90547996 CTGTGGCCCAGCTCTGGGTGGGG + Intronic
1121050523 14:90816538-90816560 CCCTGCCCCAGCCCTGGCTCCGG - Intergenic
1121124972 14:91400069-91400091 CTGCTCCCCAGGCCTGTGTCTGG + Intronic
1121311820 14:92939463-92939485 CGGCCCCCCAGCCCTGGGTGTGG + Exonic
1122070110 14:99200656-99200678 CTGTGACCCAGCCCTGGAGCTGG - Intronic
1122204598 14:100142290-100142312 CTGTTCCCCAGCCCAGGGCCAGG - Intronic
1122238975 14:100349376-100349398 CTGTACCCCCACCATGAGTCTGG + Intronic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122919776 14:104875237-104875259 AAGTCCCCCAGCCCTGGGACAGG - Intronic
1123150599 14:106177983-106178005 CTGTGCACCAGCTCTGGGGCTGG + Intergenic
1123202717 14:106681704-106681726 CTGTGCACCAGCTCTGGGGCTGG + Intergenic
1123405304 15:20016611-20016633 CTGTGCTCCAGCCCCGGGTGTGG + Intergenic
1123514634 15:21023259-21023281 CTGTGCTCCAGCCCCGGGTGTGG + Intergenic
1123843171 15:24269680-24269702 CTGGACCCCAGCCCTGGCAATGG + Intergenic
1123862844 15:24486220-24486242 CTGGACCCCAGCCCTGGCAATGG + Intergenic
1124932137 15:34131218-34131240 CTGTATCCCAGCACTTGGGCAGG + Intergenic
1125731621 15:41895409-41895431 CTGAAGCCCAGCCTTGGGGCAGG - Intergenic
1125840023 15:42791662-42791684 CTGAACCTCAGCCCTTGGGCAGG + Intronic
1129002353 15:72345386-72345408 GGGTTCCCCAGCCCTGGATCTGG + Intronic
1129704260 15:77785515-77785537 CTGTCCCCCTGCCCTTAGTCAGG + Intronic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1132142833 15:99409226-99409248 CTCCAGCCCAGCCCTGGCTCTGG - Intergenic
1132205517 15:99983673-99983695 CTGTCTCCCCGCACTGGGTCTGG + Intronic
1132506445 16:311892-311914 CTGCCACGCAGCCCTGGGTCGGG - Intronic
1132594304 16:741193-741215 CTGCACCCCAACCCGGGGCCTGG - Intronic
1132658788 16:1052549-1052571 CTGCACCCCATCCCTGGAGCAGG + Intergenic
1132681523 16:1144395-1144417 CTGTACCCCAGGCCCGGCTGGGG - Intergenic
1132746700 16:1439223-1439245 CTGTCCCCAAGCCCTGAGCCCGG + Intronic
1132859827 16:2064684-2064706 CTGGAGCCCAGACCTGGGGCTGG + Intronic
1132983353 16:2750673-2750695 CTGCACTCCAGCCCGGGGTTAGG + Intergenic
1133171624 16:3985661-3985683 CTGTACCCGAGCCCTTGGCTTGG - Intronic
1133326508 16:4945294-4945316 GTGGACCCCAGCCATGGGTGGGG - Intronic
1133388907 16:5393222-5393244 CTGTACCCCAGCACTGGACACGG + Intergenic
1134091953 16:11396306-11396328 CTGAACCCCAGGCCTGGCCCTGG - Intronic
1135614959 16:23903156-23903178 CTTTACCACAGCTCTGAGTCAGG - Intronic
1135839969 16:25867192-25867214 CTGTAAACCAGCCCTGGATCTGG - Intronic
1138206404 16:55128501-55128523 CTCTACTCCATCCCTGGGCCTGG + Intergenic
1138477958 16:57283359-57283381 CTGGACCTCAGCCCAGGGTCTGG + Intronic
1138583569 16:57956841-57956863 CTTTATCCCAGCCCTGAGCCAGG - Intronic
1138659682 16:58509718-58509740 CTGACCCCAAGCCCTGGGGCGGG - Intronic
1139957493 16:70700116-70700138 CTGAACGCCAGCCATGGCTCTGG + Intronic
1140415810 16:74773496-74773518 ATGTTCCCCAGGCCTGGCTCTGG - Intronic
1141274032 16:82568776-82568798 CTGTACCCCAGCACAGTGTCTGG + Intergenic
1141664183 16:85457425-85457447 CTGTATCCCTGCCCCAGGTCAGG - Intergenic
1142599805 17:1048078-1048100 CTCTAGCCCAGCCCAGGGACAGG + Intronic
1143523656 17:7460727-7460749 CTGTACCCCATCCCTAGGCTGGG + Exonic
1143893206 17:10117981-10118003 CTGTAGCCCAGACCTGGGCTAGG + Intronic
1143977986 17:10844427-10844449 CTCCACCCCAACCCTGGGGCTGG - Intergenic
1144737608 17:17563841-17563863 CTGTGCCCCACTCCTGGGTGAGG - Intronic
1144949422 17:18985892-18985914 CCCTACCCCAGCCCAGGGCCTGG + Intronic
1145886079 17:28383467-28383489 CTGCACTCCAGAGCTGGGTCAGG + Intronic
1146721047 17:35123699-35123721 CTGCACTCCAGCCAGGGGTCTGG + Intronic
1147324829 17:39665205-39665227 CCCAACCCCTGCCCTGGGTCCGG + Exonic
1147538386 17:41335427-41335449 CTCTACCCCAACCCTGGAGCAGG + Intergenic
1147949952 17:44101826-44101848 GTGTAAGCCAGCCCTGGGACAGG + Intronic
1147965754 17:44193470-44193492 CTCCTCACCAGCCCTGGGTCAGG + Exonic
1148558108 17:48590649-48590671 CTGGGCCCTAGCCCTGGGCCAGG + Intronic
1148737641 17:49873819-49873841 CTGGACCCCAGCCTAGGCTCTGG + Intergenic
1148888833 17:50793203-50793225 CTGCACCCCACCACTGGATCCGG + Intergenic
1150722903 17:67628603-67628625 CTGTGAACCAGCCCTGGCTCAGG - Intronic
1151476457 17:74346800-74346822 CTGACCCACAGCCCTGGGTGGGG - Intronic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1151826578 17:76527288-76527310 CTGTCCCCCATCCCCGGTTCTGG - Intergenic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152242563 17:79168006-79168028 CTGGACCCCAGCCCCAGGGCTGG + Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152612897 17:81324266-81324288 CTGGACCCCAGGCCTGGTGCTGG + Intronic
1154175962 18:12087425-12087447 CCGTAGCCCAGACCTGGTTCTGG + Intergenic
1154405135 18:14083965-14083987 CTATACCCAAGACCTGGGTTGGG - Intronic
1157196761 18:45625994-45626016 GTGGACTCCAGCCCTGGGTGAGG - Intronic
1160825902 19:1080526-1080548 CTGGACCCCGGCCCTGGCGCAGG + Exonic
1161821050 19:6531509-6531531 CTGTACCCCAGGCCGGGGGCGGG + Intronic
1161993602 19:7699021-7699043 CAGTGACCCAGCCCTGAGTCAGG - Intronic
1163288779 19:16365154-16365176 CTGCAGCCAAGCCCTGGGGCTGG + Intronic
1163525469 19:17818275-17818297 CTGTACCCTAGTCCTGGCCCTGG - Intronic
1163745275 19:19043139-19043161 CTGTTTCCCAGGCCAGGGTCAGG - Intronic
1164222121 19:23204105-23204127 CTCGACTCCAACCCTGGGTCCGG - Intergenic
1164603563 19:29579793-29579815 AGGCACCCCAGGCCTGGGTCAGG + Intergenic
1165332901 19:35151180-35151202 CTGGAGCCCAGTCCTGGCTCTGG - Intronic
1165408727 19:35645378-35645400 CTGTGTCCCTGCCCTGTGTCGGG + Intergenic
1165908455 19:39208451-39208473 CTGTCCTCCATCCCTGTGTCTGG - Intergenic
1166102369 19:40578294-40578316 CTCTACCCCAGCCCTCTTTCAGG - Intronic
1166383644 19:42368741-42368763 CTGAGCCCCACCTCTGGGTCTGG - Intronic
1166667455 19:44689569-44689591 CTGCAGCCCAGCCCTGGGCCAGG + Intergenic
1166778718 19:45328396-45328418 CAACTCCCCAGCCCTGGGTCTGG - Intergenic
1167116095 19:47489842-47489864 CTGTATGCCAGGCCTGGGGCTGG + Intronic
1168171427 19:54592462-54592484 CTGTACTCCAGCCCTGAAGCTGG - Intronic
925190088 2:1875618-1875640 CTGTCCCCAAGCACTGGGCCAGG + Intronic
925351174 2:3201522-3201544 CTGTGCCCCCGCTCTGTGTCTGG - Intronic
926759127 2:16261913-16261935 CTGTCCTCCTGCCCTGGGTTTGG + Intergenic
929958648 2:46479815-46479837 ATGTACCCCAGCCCTGTAACTGG + Intronic
930868858 2:56149790-56149812 CTGGACCCCATCACTGTGTCCGG - Intergenic
931495726 2:62804956-62804978 CTTCACCCCAGCCCTGGTCCTGG + Intronic
931778747 2:65562171-65562193 CTGTGGCCCAGCCCTGGTGCTGG - Intergenic
934474806 2:94586944-94586966 CTGAGCCCCAGCCCTGGGGAAGG - Intergenic
934731285 2:96660027-96660049 CTCTACCCTACTCCTGGGTCAGG - Intergenic
937007548 2:118531066-118531088 ATGTACTGTAGCCCTGGGTCAGG - Intergenic
937123743 2:119459660-119459682 CTGTACGCCAGCCCTGTGCTGGG - Intronic
938426233 2:131191586-131191608 CTATAGCCCACCCGTGGGTCCGG - Intronic
938810043 2:134844515-134844537 CCGTACCCCACCCCTCGGTCAGG - Intronic
940000595 2:148963281-148963303 CTGTACCTCAGCTTTGGGTAAGG + Intronic
941164795 2:162073711-162073733 CTCTACCCCTGCCCGGGTTCGGG + Intronic
941432407 2:165427689-165427711 CAGTATCACAGCCCTGGCTCAGG - Intergenic
941816195 2:169798623-169798645 CTGTACCCCAGCCCTTCCTTTGG - Intronic
945416045 2:209574213-209574235 CTGTCCCCCAGCCCTGTCACTGG + Intronic
946050751 2:216860295-216860317 CTGAATCCCAGCCCTGTGCCAGG + Intergenic
946179159 2:217939702-217939724 CTGTAGCTCAGCCCTGGGTGTGG - Intronic
946418115 2:219550759-219550781 CTCTACCCCTGCCCAGGGTAAGG + Exonic
947740531 2:232482821-232482843 CTGACCCCCAGCTCTGGGCCAGG + Intronic
947743816 2:232497418-232497440 CTGTACCCCAGGCGTGGGGTGGG - Intergenic
948024365 2:234765101-234765123 TTCTCCCCCAGCCCTGGGTGGGG - Intergenic
948551463 2:238775597-238775619 CTGGACTCCAGCCCTGACTCAGG - Intergenic
948785957 2:240353111-240353133 CTGGCCTCCAGCTCTGGGTCTGG + Intergenic
949040776 2:241849190-241849212 CTGGACCCCATGCCTGTGTCAGG - Intergenic
1168887272 20:1268224-1268246 CTGTAGCCCAGCATTGGGTTTGG + Intronic
1168892747 20:1305568-1305590 CTGTCCCACAGACCTGGGCCTGG - Exonic
1169197641 20:3692135-3692157 CTGTATCACAGCCATGGATCTGG + Exonic
1169268178 20:4180370-4180392 CTGTCCCCCAGCCCTGGGCTAGG - Intronic
1170864634 20:20142548-20142570 CTGTGGCCCAGGCCTGGGCCAGG + Intronic
1172064106 20:32207422-32207444 CTGGACCCCATACCTGTGTCTGG - Intronic
1172114084 20:32563352-32563374 CTGAATACCTGCCCTGGGTCAGG + Intronic
1173257728 20:41406864-41406886 CTGTACACCTCCCCTGGGTGAGG - Intronic
1173322260 20:41998701-41998723 CGGCGCCGCAGCCCTGGGTCTGG + Intergenic
1173848620 20:46203500-46203522 CAGCAGCTCAGCCCTGGGTCTGG + Intronic
1174354105 20:49987099-49987121 CTGAGCCCCAGCCCAGGGCCTGG - Intronic
1174368155 20:50068708-50068730 CTGCACCCCAGCCCAGAGTGGGG - Intergenic
1174488162 20:50874222-50874244 GTGGACCCCAGCCCTTTGTCTGG + Intronic
1176171887 20:63699843-63699865 CTATACCCCACGCCTGGGCCTGG - Exonic
1176240373 20:64073106-64073128 CTTCTCCCCAGCCCTGAGTCTGG + Intergenic
1176515489 21:7780605-7780627 CTGTAGACCAGCCCTGGCCCAGG - Intergenic
1178180923 21:30160591-30160613 GTGAACCCCATTCCTGGGTCTGG - Intergenic
1178422447 21:32453131-32453153 CTGTGCCCCACCTCTGGGCCTGG + Intronic
1178497425 21:33099165-33099187 CTGTACCCCAGCCGGGGGACAGG + Intergenic
1178649517 21:34410617-34410639 CTGTAGACCAGCCCTGGCCCAGG - Intergenic
1178663799 21:34529223-34529245 TTGTACCAGAGCCCTGGATCAGG + Intronic
1179097619 21:38329631-38329653 CTGTGCTCCAGCCCTGGGACAGG + Intergenic
1179265172 21:39796633-39796655 CTGGGCCCCAGCTCTGGGCCTGG - Intronic
1180467403 22:15625714-15625736 CTATAGCCCACCCATGGGTCCGG - Intergenic
1181855335 22:25777492-25777514 CTGGACCCTAGGCCTGGGGCGGG + Intronic
1182451961 22:30427044-30427066 CTGTACCCCACTCCTGGGTGCGG + Intronic
1183902965 22:41020274-41020296 CTGTCCCCCAGCTCTGGGGAGGG - Intergenic
1183985182 22:41565876-41565898 CTGTCCCCCGGCCCTGAGTTTGG - Intronic
1184114146 22:42412482-42412504 GTGTTCCCCAGCCCTGGATGGGG - Intronic
1184836075 22:47021815-47021837 CTGAACCCCAGCACTGGGGCGGG - Intronic
1185275524 22:49948880-49948902 CTGTCCCCCAGCCCTGGCCAGGG + Intergenic
950170442 3:10835307-10835329 CTGGACCCCAGCCATGGGGTGGG + Intronic
950429719 3:12943854-12943876 CTGCAGCCCAGCCCTGGCTCAGG - Intronic
952712423 3:36444696-36444718 CTGTATCCAAGCCCTTTGTCAGG - Intronic
953449157 3:42991846-42991868 CTGGACCCCAGCTCAGGGACTGG + Intronic
954004112 3:47578535-47578557 CGGGACCCCTGCCCTGGGTGGGG + Intronic
955083188 3:55676796-55676818 CTGTGCGCCAGCCCTGGCACAGG + Intronic
957048072 3:75391969-75391991 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
957074475 3:75590845-75590867 CTGTAACACAGCCCTGTGTTGGG + Intergenic
961280913 3:125765586-125765608 CTGTGCCTCAGCCCTGGCTGGGG + Intergenic
961874772 3:130013728-130013750 CTGTAACACAGCCCTGTGTTGGG + Intergenic
962482443 3:135809407-135809429 CTGTGCCCCTTCTCTGGGTCTGG + Intergenic
963003300 3:140703516-140703538 AGGTACCACAGCCCTGGGGCAGG + Intergenic
963047045 3:141110159-141110181 CAGAACTCCAGCCCTGGGACAGG - Intronic
963919011 3:150888068-150888090 CTGTACTCCAGCCCGGGAGCCGG + Intronic
964503718 3:157376042-157376064 CTCTGCCCCAGGCCTGTGTCAGG + Intronic
967872790 3:194246150-194246172 CAGCACCCCATCCCTGGGTAGGG + Intergenic
968291280 3:197541708-197541730 CTGTGCCTCACCTCTGGGTCAGG - Intronic
968604799 4:1529799-1529821 CTCTGCCCCAGCCCTGGGCTCGG - Intergenic
968744614 4:2353202-2353224 CTGCACCCCAGCCCTGGCTCTGG - Intronic
968811480 4:2801396-2801418 CGGTTCCCCAACCCGGGGTCTGG + Intronic
968987112 4:3881516-3881538 CTGTAACACAGCCCTGTGTTGGG + Intergenic
968992531 4:3924426-3924448 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
969018087 4:4118474-4118496 CTGTAACACAGCCCTGTGTTGGG + Intergenic
969362229 4:6672243-6672265 CTGCACCCCAGCCCAGTGACAGG - Intergenic
969795121 4:9521698-9521720 CTGTAACACAGCCCTGTGTTGGG - Intergenic
969822823 4:9733196-9733218 CTGTGCCCCACCTCTGGGCCTGG + Intergenic
972380604 4:38516134-38516156 CTGTACTCCAGCCTTGGTTATGG + Intergenic
972735014 4:41832001-41832023 CTGTAAGCCAGACTTGGGTCAGG - Intergenic
972823695 4:42731929-42731951 CTGTACCCCAGCCTGGGGCCTGG + Intergenic
977789251 4:101079198-101079220 CTGGACACCAGGCCTGGGCCAGG + Intronic
978400270 4:108323658-108323680 CTGTGAGCCAGGCCTGGGTCAGG - Intergenic
978807764 4:112818433-112818455 ATGTTCCCCAGCCCTGGTTTTGG + Intronic
979307376 4:119162496-119162518 CGTTACTCCTGCCCTGGGTCAGG - Intronic
981600408 4:146481639-146481661 CTGCATCCCAGCCCAGGGTTTGG + Intronic
981614740 4:146634681-146634703 CTATCCCCCACCCCTGGGTGAGG - Intergenic
982421805 4:155208074-155208096 CTGCGCCCCAGCCCTGGGCGAGG + Intergenic
985553086 5:543101-543123 CTGCAGCCCAGCCCTGGCCCCGG - Intergenic
985640781 5:1062661-1062683 CAGCCCCCCAGCCCTGGGTATGG - Intronic
992186389 5:74248736-74248758 GTGAAGCCCAGCCCTGGGGCAGG - Intergenic
995509300 5:112892315-112892337 CTGTACTCCAGGCTTGCGTCAGG - Exonic
996887469 5:128374652-128374674 CTGTCCCCCAGGCCTGGCTGTGG - Exonic
998151536 5:139760166-139760188 CCCTACCCCAGTCCTGGGCCTGG + Intergenic
998174835 5:139895310-139895332 CTGTATCCCAGCCCTGCGCTGGG - Intronic
998381538 5:141729518-141729540 CTGTGCCCCAGGCCTGGCTCTGG + Intergenic
998656806 5:144190250-144190272 CTGTACCTCAACCCAGTGTCTGG + Intronic
999032737 5:148312309-148312331 CTGTAACACAGCCCAGGGTGTGG + Intergenic
1000921286 5:167140936-167140958 CTATACCCCAGCACTGCCTCAGG - Intergenic
1001924338 5:175625471-175625493 CTGAACCCCAGAACTGGGCCAGG - Intergenic
1002171737 5:177378505-177378527 CAGCTCCCCAGCACTGGGTCAGG - Intergenic
1003030164 6:2594572-2594594 CTGTAGCCCAGACCTGTGCCAGG - Intergenic
1006674763 6:35754552-35754574 CTGGATCTCAGCCCTGGGTGGGG - Intergenic
1010236554 6:73579664-73579686 CTGTGCCCCAGCCTTGGGGTGGG + Intergenic
1013015857 6:106160078-106160100 TTGCGGCCCAGCCCTGGGTCAGG + Intergenic
1018175191 6:161172378-161172400 GTGTACCCCAGGCCTGGATGGGG - Intronic
1018370274 6:163162065-163162087 CTGTCCCACAGCCTTGGGTATGG + Intronic
1018879329 6:167861010-167861032 CTGTACCTCAGCCCTGCTGCTGG + Intronic
1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG + Intronic
1019696916 7:2451343-2451365 CTGTCCCGCAGCCCTGGGAGTGG + Intergenic
1019794526 7:3039976-3039998 CGGCACTGCAGCCCTGGGTCTGG + Intronic
1020000031 7:4750282-4750304 AAGTACCCCAGGCCTCGGTCAGG - Intronic
1020137389 7:5594591-5594613 CGGGACCCGAGCCCTGGGCCCGG - Intronic
1020315182 7:6900782-6900804 CTGTGCCCCACCTCTGGGCCTGG - Intergenic
1021575421 7:22101727-22101749 CTGTGAGCCAGCCCTGGGCCAGG + Intergenic
1021882307 7:25106736-25106758 CTCTACCCCAGCCCTGTCCCTGG - Intergenic
1022644242 7:32215926-32215948 CTTTGCCACAGCCCTGGGTCTGG + Intronic
1022691179 7:32656778-32656800 CTGTCCCCCAGGTCTGGGTAGGG + Intergenic
1022942558 7:35254281-35254303 CGGTACCCCAGCACAGGTTCAGG + Intergenic
1026826721 7:73587092-73587114 GTGTGCCCCAGCCCTGGCACAGG - Intergenic
1027883603 7:83874307-83874329 CTGTAAGCCAGACCTTGGTCAGG - Intergenic
1029162776 7:98564313-98564335 CTGTTCCCCAGCTCTGAATCTGG - Intergenic
1030290764 7:107870607-107870629 CTGAACTCCAGCCCTGTGGCTGG - Intergenic
1031495728 7:122445776-122445798 CTGCACTCCAGCCCTGAGACAGG + Intronic
1031512435 7:122666960-122666982 CTGGATCCCAGCCCTGGGGGAGG + Intronic
1031929224 7:127667534-127667556 CTGTCCCCCATCCCTGGATCAGG + Intronic
1033255502 7:139797833-139797855 TTGGACCCCAGCCATGGATCTGG + Intronic
1033328350 7:140398097-140398119 CTGTCCTCCGGCCGTGGGTCTGG - Intronic
1033447801 7:141437529-141437551 GTATACCCCAGCCCTGGGGTGGG - Intronic
1034237664 7:149585284-149585306 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034240745 7:149608943-149608965 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034273322 7:149813619-149813641 CTGTCCCCCAGCACTGCGTGTGG + Intergenic
1034815727 7:154170487-154170509 CTGAGCCCCAGCCCAGGGTTGGG - Intronic
1035022268 7:155806718-155806740 CTCTTCCCCAGCCCAGGGCCCGG - Intronic
1035317206 7:158003603-158003625 CAGTCCCCAAGGCCTGGGTCTGG - Intronic
1035367179 7:158356936-158356958 CTGGGCCCCAGCACAGGGTCAGG + Intronic
1035397876 7:158546906-158546928 CTGTCCCCCAGCCCTGCCCCAGG - Intronic
1035418302 7:158707220-158707242 CTGTGTCACAGCCCTGGCTCGGG + Intergenic
1035660490 8:1343940-1343962 CTGTACACCTGCCCTCGGCCAGG - Intergenic
1035740626 8:1925605-1925627 CTGAAGCCCAGTCCTGGGCCAGG + Intronic
1036494313 8:9255648-9255670 GTGTAGCCCAACTCTGGGTCTGG + Intergenic
1036692088 8:10950388-10950410 CTCTCCCCCAGCCCTGGCACAGG - Intronic
1041467448 8:58171014-58171036 CTTTACCCTCGCACTGGGTCAGG - Intronic
1042226106 8:66515625-66515647 CTGTCCCCCTGCTCTGGGTCTGG - Intronic
1042901815 8:73736535-73736557 CTCTTCCCCACCCCTGGGTTTGG - Intronic
1044139641 8:88634817-88634839 GTTTACCCAAGCCCTGGTTCAGG - Intergenic
1045294718 8:100863061-100863083 CTGTCCCTCAGGCCTGGGGCTGG + Intergenic
1045404525 8:101852427-101852449 CTGCAACCCAGCTCTGGCTCTGG + Intronic
1047424376 8:124731836-124731858 CTGTCCCCCAGGCCTAGGCCAGG - Intergenic
1047482051 8:125293069-125293091 CTGTGCCCCAGCTCTGTTTCAGG + Intronic
1048030987 8:130631931-130631953 CTCTACCCCAGCTCTGGGAGTGG + Intergenic
1048579160 8:135716651-135716673 CTGTACCCCAACCCTAGATGAGG + Intergenic
1048662319 8:136618689-136618711 CTGTATCCCAGCTCTGTGCCTGG + Intergenic
1049587804 8:143440072-143440094 CAGGAGCCCAGCCCAGGGTCCGG - Exonic
1049965557 9:776130-776152 ATGTACTCCAGCTGTGGGTCTGG - Intergenic
1052855244 9:33402815-33402837 CTGAGCCCCAGCCCTGGGGAAGG + Intergenic
1053683256 9:40499157-40499179 CTGAGCCCCAGCCCTGGGGAAGG + Intergenic
1053933237 9:43127473-43127495 CTGAGCCCCAGCCCTGGGGAAGG + Intergenic
1054280458 9:63125771-63125793 CTGAGCCCCAGCCCTGGGGAAGG - Intergenic
1054296361 9:63334655-63334677 CTGAGCCCCAGCCCTGGGGAAGG + Intergenic
1054394378 9:64639160-64639182 CTGAGCCCCAGCCCTGGGGAAGG + Intergenic
1054429027 9:65144359-65144381 CTGAGCCCCAGCCCTGGGGAAGG + Intergenic
1054501357 9:65877176-65877198 CTGAGCCCCAGCCCTGGGGAAGG - Intergenic
1056840299 9:89993219-89993241 CTGTGCTCCAGCCCTGGGCACGG - Intergenic
1057188870 9:93075000-93075022 CTGTACCCCAGCCCGGGTACAGG + Intronic
1057276218 9:93677208-93677230 CTGCACCCCAGCCGTGGGGCCGG + Intronic
1057521444 9:95763695-95763717 CTGGACACCTGCTCTGGGTCTGG + Intergenic
1059750346 9:117241719-117241741 CTGGTCCACAGCCCTGGGTTTGG + Intronic
1060231313 9:121827448-121827470 CTCGACCCCAGCTCTGGGACTGG + Intronic
1060556961 9:124512937-124512959 CTGGGCTCCAGCCTTGGGTCTGG + Intergenic
1060667596 9:125441723-125441745 CGGAAGCCCAGCCCTGTGTCCGG - Intronic
1060820498 9:126658950-126658972 CTGTATCCCAGCCTTGGATCAGG - Intronic
1061002269 9:127909015-127909037 CTGTGCCCCAGCCATGGCCCTGG - Intronic
1061413327 9:130432539-130432561 CAGGGCCCCAGCCCTGGGTAAGG + Exonic
1061764735 9:132874591-132874613 CTGTGCTCCGGCCTTGGGTCAGG + Intronic
1061798259 9:133100933-133100955 CTGTACCCCAGCCCTGGGTCAGG - Intronic
1062071194 9:134555862-134555884 CTGCATGCCAGCCCTGTGTCGGG + Intergenic
1062107665 9:134764498-134764520 CTCTGCCCCAGCCCTGGGCATGG + Intronic
1062121061 9:134834237-134834259 CTGCACCCGATCGCTGGGTCGGG - Intronic
1062194712 9:135266613-135266635 CTGTGCCCCCGCCCTGGATGGGG - Intergenic
1062208248 9:135348999-135349021 CTGTGCTCCAGCCCAGGCTCAGG + Intergenic
1062232358 9:135488800-135488822 CGGCAGCCCAGCCCTGGGCCTGG + Exonic
1062388828 9:136326120-136326142 CTTTGCCACAGCCCTGGGCCTGG - Intergenic
1062408252 9:136408320-136408342 CTGTACCCCAGCACTGTGGGAGG + Intronic
1062626963 9:137447775-137447797 CTGTCCCCCAGCCACGGGGCAGG + Exonic
1062652057 9:137582918-137582940 CTGTAGCCCAGCCTTGGTTTGGG - Intronic
1062656742 9:137607503-137607525 CTGAACCCCAGCCCTGGACTGGG - Intronic
1187064064 X:15815780-15815802 CTGTACTCCAGGCTTGCGTCAGG - Exonic
1188100213 X:26073355-26073377 CTGAAACCCAACCCTGGGGCAGG + Intergenic
1191129824 X:56995628-56995650 CTGTACCACAGCCCTGGGCGTGG + Intergenic
1191902520 X:66054791-66054813 CTCCTCACCAGCCCTGGGTCAGG + Intergenic
1192198361 X:69047393-69047415 CTGAGCCCCAGACCAGGGTCAGG - Intergenic
1192233941 X:69284494-69284516 CTGTTCCCCAGCTCTTGTTCTGG - Intergenic
1192584671 X:72309538-72309560 CTGTGCTCCAGCGCTGGGCCTGG + Intergenic
1200107444 X:153723087-153723109 CTGTGCCCTAGCCCTGGGACTGG - Intronic
1200130824 X:153844231-153844253 CTGTACTCCAGCCCTGGCAATGG + Intergenic
1200157395 X:153984525-153984547 CAGGCCCCAAGCCCTGGGTCGGG - Intergenic
1200232587 X:154451402-154451424 GATCACCCCAGCCCTGGGTCTGG + Intergenic