ID: 1061798572

View in Genome Browser
Species Human (GRCh38)
Location 9:133102356-133102378
Sequence AATCCTACCCTGCTGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061798572_1061798578 11 Left 1061798572 9:133102356-133102378 CCAGTCAGCAGCAGGGTAGGATT 0: 1
1: 0
2: 1
3: 16
4: 110
Right 1061798578 9:133102390-133102412 CTCCCTGACTCCCTGAGCCCAGG 0: 1
1: 0
2: 1
3: 58
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061798572 Original CRISPR AATCCTACCCTGCTGCTGAC TGG (reversed) Intronic
900254566 1:1691343-1691365 CATCCTTCCCTTCTGCTGTCTGG + Exonic
900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG + Intronic
909948511 1:81690994-81691016 AATTTTCCCCTGCTGCTGATTGG - Intronic
910191244 1:84598136-84598158 CATCCTACCCCGCAGCTGAGGGG + Intergenic
911182517 1:94873968-94873990 AATCCTCCACCCCTGCTGACTGG + Intronic
911184130 1:94886514-94886536 CCTCCTACCCTGCTGGAGACAGG + Intronic
911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG + Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
911971204 1:104440226-104440248 AATCCTTCATTGCTACTGACAGG + Intergenic
912480574 1:109979423-109979445 AATCCTTTCCTGCAGCAGACGGG + Intergenic
915766227 1:158365379-158365401 AATCCTATCAGGCTGCTGATGGG + Intergenic
916243921 1:162667811-162667833 AAGCCTAACCAGATGCTGACTGG - Intronic
922899143 1:229122907-229122929 ATTCCTGCCTTGCTGCTGAGTGG + Intergenic
924470943 1:244342081-244342103 AATGATCTCCTGCTGCTGACGGG + Intergenic
1068912202 10:62390133-62390155 ATTCTTACTCTGCTTCTGACTGG + Intronic
1072298082 10:94031584-94031606 AATACTGCCCTTCTGCTGTCAGG - Exonic
1072306340 10:94111242-94111264 AATCCCACCCTGCAGCTGGAAGG - Intronic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1076545670 10:131244464-131244486 AATCTTAGCCAGCTGCTGAGAGG - Intronic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG + Intronic
1087825417 11:102759480-102759502 AATCCAACCCTACTTCTAACTGG + Intergenic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1092069180 12:5618860-5618882 GATGATACTCTGCTGCTGACAGG - Intronic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1096321642 12:50619362-50619384 AGTTGTACTCTGCTGCTGACTGG - Intronic
1099942754 12:89209054-89209076 AATCATACTCTGCAGCAGACTGG + Intergenic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1105303471 13:19154237-19154259 AGTCCCACCCAGCTGCTGCCTGG - Intergenic
1105705164 13:22963819-22963841 GAGCCTCGCCTGCTGCTGACGGG + Intergenic
1109134147 13:58625772-58625794 CCTTCTGCCCTGCTGCTGACAGG + Intergenic
1114613530 14:24056737-24056759 GACCCTACCCTGGTGCTGCCTGG + Intronic
1115135600 14:30103967-30103989 ACTACTACCCTGCTGATGATCGG - Intronic
1116955032 14:50914600-50914622 AAGCCAGCCCTGCTGCAGACTGG + Intronic
1123543404 15:21318150-21318172 AATACTAATATGCTGCTGACGGG + Intergenic
1125688644 15:41578866-41578888 CATGCTTCCCTGCAGCTGACCGG + Exonic
1126357917 15:47815689-47815711 GCTCCTATCCTCCTGCTGACAGG + Intergenic
1127455588 15:59153582-59153604 AATCTTACCCTGCAGCTCCCTGG + Exonic
1129530040 15:76258376-76258398 GATGCTTCCCTGCAGCTGACCGG - Intronic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1132783926 16:1643926-1643948 AATCTTGCCATCCTGCTGACAGG - Intronic
1132988990 16:2783476-2783498 AAACCTACTCTGGAGCTGACAGG - Intergenic
1135465528 16:22681568-22681590 AATGCTCGCCTGCTGCTGGCTGG + Intergenic
1138565198 16:57828041-57828063 AATCCCAGCCTGCTCCTTACTGG - Intronic
1143850460 17:9807809-9807831 ACTCCTACCCAGGTTCTGACAGG - Intronic
1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG + Intronic
1146889641 17:36498102-36498124 AATCCAAACCTGCAGCTGATTGG + Intronic
1147880853 17:43652397-43652419 AGTCCTCCCCTGATGCTGGCTGG - Intronic
1148763305 17:50020758-50020780 AGTTCTACCCTGGTGCTGGCTGG - Intergenic
1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG + Intronic
1152877171 17:82793510-82793532 TTTCCTGCCCTGCTGCTGAGGGG + Intronic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1161769342 19:6222898-6222920 AATCTTAGCCTGCAGCTGCCGGG - Intronic
926028921 2:9568713-9568735 AATACTAACCTGCCTCTGACAGG - Intergenic
929894131 2:45943797-45943819 CAGCCTCCCCTGCTGCTGTCTGG - Intronic
931954081 2:67397958-67397980 ACTCCACCACTGCTGCTGACTGG - Intronic
932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG + Intergenic
933485316 2:82914441-82914463 ACTCATAACCTGCTGTTGACTGG + Intergenic
937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG + Intergenic
939551509 2:143621355-143621377 AACCCTACCCTGGTGTTAACAGG - Intronic
940510493 2:154607803-154607825 AATCCCACCTTTCTGCTGATAGG - Intergenic
948602884 2:239117279-239117301 AAGCATGCCCTGCTGCAGACAGG + Intronic
948815709 2:240509391-240509413 AATCCTAACCTGCTGTGGAGTGG - Exonic
1168852511 20:986260-986282 AGTCCCTCCCTGCTGCTCACTGG + Intronic
1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG + Intronic
1173398496 20:42702985-42703007 GATCATACCCTGCTGCTGGCAGG - Intronic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG + Exonic
1180055021 21:45353099-45353121 AATCCTACCCTGAGGCTGACAGG - Intergenic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
951682588 3:25310001-25310023 AATACTACCATGCTGCTAACAGG - Intronic
955017888 3:55089602-55089624 AACACTGCTCTGCTGCTGACTGG - Intergenic
956420932 3:69085605-69085627 AACCCTACCCTGGAGCTGGCTGG + Intronic
963309968 3:143699469-143699491 CATGCTACACTGCTGCTGCCAGG - Intronic
964479498 3:157127659-157127681 GATGCTACCCTGCTGCTGGCGGG - Intergenic
965216816 3:165874517-165874539 AAGCCTACCCAGCTCCTGGCTGG + Intergenic
965756272 3:172030804-172030826 ACTACTACCCTACTGTTGACTGG - Intergenic
966379198 3:179326210-179326232 AATCCCAGCCTCCTGCTGGCGGG + Intronic
967075129 3:185994925-185994947 AAACCTACCCTGTTGCTCCCAGG - Intergenic
967129687 3:186458987-186459009 AATCCTGCTCTGCTGCTTACTGG - Intergenic
967373800 3:188778496-188778518 AATCCAACCCTGCTGTAGATAGG + Intronic
970226271 4:13860514-13860536 AATCACACCCTGCTGCTTACAGG + Intergenic
970628347 4:17914577-17914599 AATGCTTCTCAGCTGCTGACTGG + Intronic
972312498 4:37893793-37893815 AACACTACTCTGCTGCTGAATGG - Intronic
974098722 4:57393903-57393925 AGTCCTTCCCTGCTGCTGCTGGG + Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
983622406 4:169774819-169774841 CATCCTATCCTGCTGTGGACCGG + Intergenic
983640375 4:169939548-169939570 ATTAATAGCCTGCTGCTGACTGG + Intergenic
986333845 5:6738187-6738209 CAGCCTTCCCTACTGCTGACTGG + Intronic
987224075 5:15821470-15821492 ATTCCACCCCTGCTGCTGAATGG + Intronic
987973016 5:24975519-24975541 ACTTCTACCCTCCTGCAGACAGG + Intergenic
989336584 5:40324333-40324355 AATGATCCCCTGCTGCTGTCTGG + Intergenic
990798719 5:59574525-59574547 AATTCAACTCTGATGCTGACTGG - Intronic
994746484 5:103684958-103684980 ATTCCTACCCTACTGCTTCCAGG - Intergenic
995064215 5:107841906-107841928 CATCTTACCCTGCTTCTGAAGGG - Intergenic
996088348 5:119326528-119326550 AATGCTTCCCTGCTGCTCAGGGG - Intronic
997560162 5:134839603-134839625 ATTCATACCCTGCAGCTGAAGGG + Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
999432521 5:151536511-151536533 ATTCCTGCCCTGCTGCTGCAGGG - Intronic
1006451672 6:34109119-34109141 AACCCTTCCTTGCTGCTGCCTGG + Intronic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1013858273 6:114602241-114602263 AATTCTACCCTGCCATTGACTGG - Intergenic
1015226066 6:130858974-130858996 GCTCCTATCCTGCTGCTCACAGG - Intronic
1016306644 6:142691682-142691704 TATCCTTTCCTGCTGCTCACTGG + Intergenic
1018787664 6:167121050-167121072 ATTGAGACCCTGCTGCTGACTGG - Intergenic
1021329335 7:19315858-19315880 AATCCTTCCCCACTGCAGACAGG + Intergenic
1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG + Intronic
1024517791 7:50274568-50274590 ACTCCTGCCTTGCTGCTGAGGGG - Intergenic
1031057284 7:117006325-117006347 CATGCTACACTGCTACTGACTGG - Intronic
1035975538 8:4306736-4306758 AACACTACCCTGCTGCGGTCGGG - Intronic
1043247846 8:78028454-78028476 ACTTCTACCCTCCTGCAGACTGG + Intergenic
1044386684 8:91597528-91597550 AACCATACTGTGCTGCTGACTGG - Intergenic
1047779501 8:128099961-128099983 AAACCCACCCTGCGGCTGGCTGG - Intergenic
1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG + Intronic
1061357810 9:130119565-130119587 ATTCCAACTCTGCTGCTCACTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061835344 9:133325066-133325088 AAACCAACCCTGCTGATGTCTGG + Intergenic
1185545979 X:946126-946148 CTTCCTACCCTGCTGTGGACAGG - Intergenic
1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG + Intergenic
1192013017 X:67295647-67295669 AAACCTAGCCTCCTGCTGATAGG + Intergenic
1194665003 X:96667712-96667734 AAACCAACCCTGCTGATGCCTGG - Intergenic
1196750096 X:119108252-119108274 ATTCCTACTCTGCTACTTACTGG - Intronic
1197481040 X:126986162-126986184 AATCCCACCCAGCAGCTGCCGGG - Intergenic
1198223243 X:134622224-134622246 AATCCTGCCTTGGTGCTGAGCGG + Intronic