ID: 1061798578

View in Genome Browser
Species Human (GRCh38)
Location 9:133102390-133102412
Sequence CTCCCTGACTCCCTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 466}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061798568_1061798578 23 Left 1061798568 9:133102344-133102366 CCAGTCTCAGGGCCAGTCAGCAG 0: 1
1: 0
2: 2
3: 17
4: 220
Right 1061798578 9:133102390-133102412 CTCCCTGACTCCCTGAGCCCAGG 0: 1
1: 0
2: 1
3: 58
4: 466
1061798567_1061798578 24 Left 1061798567 9:133102343-133102365 CCCAGTCTCAGGGCCAGTCAGCA 0: 1
1: 0
2: 1
3: 22
4: 190
Right 1061798578 9:133102390-133102412 CTCCCTGACTCCCTGAGCCCAGG 0: 1
1: 0
2: 1
3: 58
4: 466
1061798572_1061798578 11 Left 1061798572 9:133102356-133102378 CCAGTCAGCAGCAGGGTAGGATT 0: 1
1: 0
2: 1
3: 16
4: 110
Right 1061798578 9:133102390-133102412 CTCCCTGACTCCCTGAGCCCAGG 0: 1
1: 0
2: 1
3: 58
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061798578 Original CRISPR CTCCCTGACTCCCTGAGCCC AGG Intronic
900225871 1:1533432-1533454 CTCCCTGTCCTCCTGAGCACAGG - Intronic
900229737 1:1550627-1550649 CGTCCTGACTCCCTGGGCCCGGG - Intronic
900234085 1:1578407-1578429 CTCGGGGACTCCCTGAGCCAGGG + Intergenic
900464983 1:2821211-2821233 CTCCTTGGCCCCCTGAGACCTGG - Intergenic
900477957 1:2884851-2884873 TAGCCTGACTCCCTGAGCCCTGG + Intergenic
900630864 1:3634471-3634493 CTCCCCGAGTCCCTGATCACTGG + Intronic
900947262 1:5838086-5838108 GCCCCTGAGTCGCTGAGCCCGGG + Intergenic
901051548 1:6428140-6428162 CTCCCAGACTCCCACAGGCCTGG - Intronic
901052191 1:6430851-6430873 CTCCCTGAGACCCAGAGCCTGGG - Intronic
901785490 1:11621897-11621919 CTCCTTGAGGCCCTGTGCCCAGG - Intergenic
901798185 1:11692305-11692327 TTCGAAGACTCCCTGAGCCCCGG + Intronic
902482044 1:16717160-16717182 CTCCCTGAGACCCAGAGCCTGGG + Intergenic
902482772 1:16720221-16720243 CTCCCAGACTCCCACAGGCCTGG + Intergenic
902547370 1:17198579-17198601 CTCCTGGTCTCCCTGACCCCAGG - Intergenic
902802881 1:18841423-18841445 CAGCCTGACTCCCTGGGCCCTGG + Intronic
903349805 1:22710892-22710914 CCCCCTGGCCCCCCGAGCCCGGG + Intronic
903356996 1:22754514-22754536 CTCTCTGGTCCCCTGAGCCCTGG - Intronic
904836771 1:33342701-33342723 CTCCCTGACTCCCTGCAGCCAGG - Intronic
904898639 1:33838061-33838083 CTTCTTGACTCCCAGAGCCTTGG - Intronic
906057758 1:42929829-42929851 CCTCCCCACTCCCTGAGCCCTGG - Intronic
906141308 1:43535366-43535388 CTCCCACCCTCCCTGGGCCCTGG + Intronic
906196168 1:43931968-43931990 CTCCCTTACCCCCCTAGCCCAGG - Intergenic
906685615 1:47761332-47761354 CTGCCCCACTCCCTGACCCCAGG - Exonic
907271525 1:53294194-53294216 CTCTGTGAGTCCCTCAGCCCAGG + Intronic
907279759 1:53339866-53339888 CACTCTGACTCCCTGTGCCCTGG + Intergenic
907311865 1:53543418-53543440 CTCCCAGAGGGCCTGAGCCCAGG + Intronic
907414896 1:54307373-54307395 CTCCCTGTCTCCCCTAGCCCGGG + Intronic
908523294 1:64965721-64965743 CTCGCTGGCTACCTGAGGCCTGG + Intronic
909920441 1:81374914-81374936 CCTCCTGACTTCCTGAGTCCAGG + Intronic
912414161 1:109496950-109496972 GTGCCTGACCCCCTGTGCCCTGG - Intronic
912711083 1:111950431-111950453 CCCCCTCACTCCCTGAGGACCGG + Intronic
914801474 1:150965771-150965793 CTCCCTGACCTCCAGAGCCAGGG - Exonic
915103315 1:153516046-153516068 CTCCCTGACTCCCTCGCCCTAGG + Intergenic
915895696 1:159809274-159809296 CTGCCTGACGCCCAGGGCCCTGG - Intronic
915982082 1:160426508-160426530 CTGCCTGATTCTCTGAGCTCTGG + Exonic
916116143 1:161486574-161486596 CTCCTTGGTTCCCTGGGCCCTGG + Intergenic
917041325 1:170809286-170809308 CTCCCAGACTCCCTGCCCCCTGG - Intergenic
917533380 1:175856505-175856527 CTCTCTGACTGCCTGCGCCATGG - Intergenic
919813098 1:201421285-201421307 CACCCTGGCTCTCTGATCCCAGG + Intronic
920042690 1:203113139-203113161 CTCCCTTCCTCCATGAGACCAGG - Intronic
920082223 1:203383169-203383191 ACCCCTGACTCATTGAGCCCAGG + Intergenic
920100196 1:203512540-203512562 CTGCCTGTCTCCCTGAGGCCAGG - Intergenic
920363840 1:205437689-205437711 TTCCCAGACTCACAGAGCCCTGG + Intronic
920381284 1:205535995-205536017 CTGCCTGGCTCACTGTGCCCTGG - Intergenic
920442283 1:205989177-205989199 CTCCCTGTCTGGCTGAACCCTGG + Intronic
920695245 1:208176859-208176881 CTCCCTTCCTCCTTGAGTCCTGG + Intronic
921048228 1:211492260-211492282 CTCCCTCACTGCCTGGGCCTGGG - Exonic
922571331 1:226636178-226636200 CTGCCTGGCTGCCTGACCCCAGG - Intronic
924415020 1:243849939-243849961 CTCCCTGCCTCCCTCAGGCGGGG - Intronic
924711104 1:246530734-246530756 TTCCTTGGTTCCCTGAGCCCTGG - Intergenic
1063357167 10:5412391-5412413 ATCCCTGAGTCCCTAAGGCCCGG - Intergenic
1063499002 10:6536355-6536377 GCCCTTGACTGCCTGAGCCCGGG + Intronic
1063859656 10:10293717-10293739 CTCCCAGCCTCCCTGACCGCTGG + Intergenic
1063940664 10:11125253-11125275 TTCTTTCACTCCCTGAGCCCTGG - Intronic
1064037008 10:11922186-11922208 CCCGCTGACTCCCTGACCTCAGG + Intronic
1064244649 10:13659089-13659111 CTCCCTGTCTCCAGAAGCCCGGG + Intronic
1064781277 10:18841437-18841459 ATCCCCAACTCCCTGAGCCATGG - Intergenic
1065131005 10:22620397-22620419 TCTCCTGACTCCCTGAGCCTGGG - Intronic
1065278037 10:24105943-24105965 CTCACTGACTCCCCACGCCCTGG - Intronic
1065540932 10:26766598-26766620 CTCCCTAACTCCCTCAAGCCAGG + Intronic
1065846545 10:29748279-29748301 CTCCCTGTCACCCTGGGCCCTGG + Intergenic
1068955700 10:62817529-62817551 CCCCCTGACCCCCATAGCCCAGG + Intronic
1069717373 10:70529797-70529819 CTCCCTGTCCCCTGGAGCCCAGG + Intronic
1069873328 10:71546508-71546530 CTCCCTAATTCCCTGAACCTGGG - Intronic
1069889291 10:71643297-71643319 CTCCCTCTCCCCCTGAGCCCAGG - Intronic
1069889647 10:71644964-71644986 CTTACTGACTCCCTGAGGTCTGG - Intronic
1070324413 10:75378518-75378540 CTCCCTCCCTCCCTCAGCCCAGG + Intergenic
1070579987 10:77711684-77711706 CTCCCTCACTCCCCTCGCCCAGG - Intergenic
1071554641 10:86592813-86592835 TTCCCTCAGTACCTGAGCCCAGG + Intergenic
1072219025 10:93311925-93311947 CTCCCTCCCTCCCTGGTCCCAGG - Intronic
1072578552 10:96720816-96720838 CGCCCTGTCTCCCAGAGGCCTGG - Intergenic
1072735372 10:97875606-97875628 CTCCCTGCCTCCCTGTGCCCAGG - Intronic
1074515170 10:114160363-114160385 TTCCCTCACCCCCTGTGCCCTGG - Intronic
1075318703 10:121472241-121472263 CTCCCTGCACCCCTCAGCCCAGG + Intergenic
1075645532 10:124093564-124093586 CAACCTGACTCCCCGAGCGCTGG + Exonic
1075689583 10:124386361-124386383 CTCAGTGCCTCCCTGGGCCCGGG - Intergenic
1075708613 10:124518299-124518321 CTCCCTCACTCCCTTAGGCCAGG - Intronic
1075888704 10:125926458-125926480 GTTCCTCACTCCCTGACCCCTGG + Intronic
1076474172 10:130740926-130740948 CTCCCTGTCTCCCTCATTCCTGG - Intergenic
1076699762 10:132265339-132265361 CTCCCTGCCACACTCAGCCCAGG + Intronic
1076712830 10:132348010-132348032 CTCCGTGACCTCCCGAGCCCAGG + Exonic
1077143147 11:1033692-1033714 CACCCTGACTCCCAGAGGCTGGG + Intronic
1077185856 11:1235021-1235043 CTCCCGGCCTTCCTGAGACCCGG - Intronic
1077249061 11:1552637-1552659 CTCCCTTACCCCCTGTGCGCAGG - Intergenic
1077291460 11:1796912-1796934 TTCCCTGCCTCCCTGAAACCTGG - Intergenic
1078456895 11:11482492-11482514 CTCCCTCTCTCAGTGAGCCCAGG - Intronic
1078760067 11:14244664-14244686 CTGCTTGACTCCCTGGACCCGGG - Intronic
1079097317 11:17519179-17519201 CTGCCTCACTCCCTGTTCCCCGG - Intronic
1079348127 11:19670622-19670644 CTCTCTGACTCACTGAGCAGAGG + Intronic
1080564249 11:33493498-33493520 ATCTCTGTCTCCCTGAGTCCCGG + Intergenic
1080726634 11:34904695-34904717 CTCTCTCCCTCCCTAAGCCCAGG + Intronic
1081662358 11:44895869-44895891 GTCCTTGTTTCCCTGAGCCCTGG + Intronic
1082767312 11:57180127-57180149 CTCCTTGTCTCCCGGATCCCAGG - Intergenic
1082791594 11:57349672-57349694 CTCCCCGCCTTCCGGAGCCCAGG - Intronic
1083033626 11:59616015-59616037 CTCCCGTCCTCCCTGAGCGCTGG - Exonic
1083297862 11:61724903-61724925 CTACCTGCCTCCCGTAGCCCTGG + Intronic
1083319907 11:61839147-61839169 CTCCCTGGCTCCATGTGCCCGGG + Intronic
1083642479 11:64153008-64153030 CTCCCAACCTCCCTGAGCCCCGG - Intronic
1083888078 11:65582333-65582355 CTCCCAGCCTCCCAGACCCCTGG - Exonic
1083996661 11:66276386-66276408 CTGCCTGCTGCCCTGAGCCCCGG + Exonic
1084051767 11:66604824-66604846 TTCCCTGACTCCCAGATTCCAGG - Intronic
1084150986 11:67287913-67287935 CTCCCTGACCCCCACATCCCTGG - Intergenic
1084336511 11:68460908-68460930 CTCCCTGAGCCGCTGAGGCCAGG - Intronic
1084782363 11:71418663-71418685 TGCCTTGACTCCCTGAGCACTGG - Intergenic
1084837689 11:71814959-71814981 CTCCCTTATTCTCTGATCCCAGG + Intergenic
1084954383 11:72683713-72683735 CTTCCTGGTTCCCAGAGCCCAGG + Intergenic
1085029912 11:73264688-73264710 CTCCCTGTATCCCCGCGCCCCGG - Intronic
1085502235 11:77034637-77034659 CAGCATGAATCCCTGAGCCCTGG - Intronic
1085775841 11:79365761-79365783 CTCCCAGACCCCCTGAGATCTGG - Intronic
1085787958 11:79471617-79471639 CTCCCTCTTTCCCTGAGCCCTGG + Intergenic
1088897916 11:114091947-114091969 CTCACTGACACCCTTAGACCAGG + Intronic
1088952731 11:114587639-114587661 CTCCTTGGCGCCCTGAGCCCTGG - Intronic
1089321782 11:117631334-117631356 CTCCCTCTCTCCCTCTGCCCGGG - Intronic
1089536461 11:119163444-119163466 CTTCAGGACTCACTGAGCCCTGG + Intergenic
1089556150 11:119316896-119316918 CTCCCTGGGTCCCCGATCCCCGG - Intronic
1089678188 11:120104605-120104627 CTGCCTGGCTCCCTGAACCAAGG + Intergenic
1090410821 11:126508511-126508533 CTCCCCGATTCCATGAGCCCTGG + Intronic
1090667676 11:128925527-128925549 ATCCTGGACTCCCTGGGCCCTGG + Intergenic
1091280760 11:134380329-134380351 CTCCCTGGCTCCCTGTCCCTGGG - Intronic
1091437047 12:481117-481139 CTCCCTCCCTCCCTGAGGCATGG - Intronic
1091582201 12:1796856-1796878 CTCCCTGCCTCCCCGGGGCCAGG + Intronic
1092838001 12:12510139-12510161 TGCCCTGATTCCCTGAGCCATGG - Intronic
1095773868 12:45991216-45991238 CCGCCTGACTCCCCGAGCCTAGG + Intronic
1095784563 12:46095086-46095108 TTCCCAGTGTCCCTGAGCCCAGG - Intergenic
1096659646 12:53116250-53116272 GTCCCTGCCTTCCTAAGCCCGGG + Intronic
1097158955 12:57032113-57032135 CTCCCTGATTCCCCAAGCCCCGG + Intronic
1097872152 12:64610578-64610600 CTCCCTGGCCGCCTGCGCCCCGG + Exonic
1102099894 12:110270194-110270216 TCCCCTGACTCCCTATGCCCTGG - Intergenic
1102360062 12:112278191-112278213 CTCTCCTACTCCCTGACCCCTGG - Intronic
1102576845 12:113861058-113861080 ATCCCTGGCTCCCAGAGCCTTGG - Intronic
1103415938 12:120741543-120741565 TTCCCTGTCCCCATGAGCCCGGG + Intergenic
1103838997 12:123847558-123847580 CTGCCTGACTGACTGAGCCAGGG - Intronic
1103917669 12:124384373-124384395 CTGCCTGAAGCCCTGAGCTCTGG + Intronic
1103969472 12:124660983-124661005 CTCCCTGGCTGCCCCAGCCCTGG - Intergenic
1104039736 12:125122011-125122033 CTCGAGGACTCCCTGACCCCAGG - Intronic
1104756438 12:131272528-131272550 TCCCCTGCCTCCCTGCGCCCAGG - Intergenic
1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG + Intergenic
1104847910 12:131856020-131856042 CACCCCGCCCCCCTGAGCCCAGG + Intergenic
1104882037 12:132078606-132078628 CGTCCTGGCTCACTGAGCCCAGG - Exonic
1105705271 13:22964424-22964446 CGCCCTGACTCCCTGCTCACAGG + Intergenic
1108350617 13:49587557-49587579 CTCCCTGACTCCCTGATTTGTGG - Intergenic
1108587046 13:51879271-51879293 GTCCCTGACCTCCTAAGCCCAGG + Intergenic
1108594226 13:51936273-51936295 CTGCCTGACTCACTGGGCTCAGG + Intronic
1112291157 13:98144437-98144459 CTCCCTGTCTCTCCCAGCCCTGG + Intronic
1113224214 13:108141505-108141527 CTCCCTTACCCCCCGAGCCTGGG + Intergenic
1113635320 13:111915217-111915239 CAGGCTGACTTCCTGAGCCCAGG - Intergenic
1113664522 13:112131976-112131998 CTTCCTGTCTCCCTGAGCACAGG - Intergenic
1113771422 13:112911546-112911568 CTCCCTCACTTCCAGAGACCTGG + Intronic
1114064441 14:19049512-19049534 CTCACTGTCTCACTGAGCTCAGG - Intergenic
1114097819 14:19350489-19350511 CTCACTGTCTCACTGAGCTCAGG + Intergenic
1114673316 14:24425333-24425355 CTCCCTGGCTTGGTGAGCCCGGG + Intergenic
1117173188 14:53121762-53121784 CTCCCTTGCTTCCTGACCCCTGG - Intronic
1117513258 14:56473712-56473734 CCCCCTGACTCCCTGTGCTGAGG + Intergenic
1117635533 14:57739291-57739313 CTCCCTGAATGCCTGAGTCCTGG - Intronic
1118615481 14:67572073-67572095 CTCCCCGACTCACGCAGCCCAGG - Intronic
1118633634 14:67727932-67727954 AGCCCTAACTCCCTGAGTCCAGG - Intronic
1119198417 14:72734281-72734303 TTCCCTGACTCCCTGATCTAAGG - Intronic
1119421068 14:74508388-74508410 GTCCCTCCCTCCCTGAGCCCCGG + Intronic
1119543643 14:75456688-75456710 CTTCCTGCCTCCCTGTGCCTGGG + Intronic
1119601399 14:75979409-75979431 CGCCCTGACTACCTCAGCCCAGG - Intronic
1120133711 14:80838483-80838505 ATCCCAGACTTCCTGAGGCCTGG - Intronic
1120554657 14:85914825-85914847 CTTCCTTCCTCCCTAAGCCCTGG + Intergenic
1121174336 14:91879463-91879485 CTCCGTGACTCCCTCACTCCAGG - Intronic
1121279103 14:92687092-92687114 CTGCCTGCAGCCCTGAGCCCCGG + Intronic
1121470925 14:94153761-94153783 CTCCCTTATTCATTGAGCCCTGG - Intronic
1121586990 14:95069229-95069251 TTCCCTGTCTCCCTTAGCCATGG - Intergenic
1122132833 14:99615317-99615339 CTCCCAGATTGCTTGAGCCCAGG + Intergenic
1122551485 14:102552431-102552453 CCCCTTGCCTCCCTCAGCCCTGG + Intergenic
1122862499 14:104588840-104588862 CTCCGAGACAGCCTGAGCCCTGG + Exonic
1123409003 15:20043287-20043309 CTCCCTGAAATCCTGTGCCCTGG + Intergenic
1123518333 15:21049995-21050017 CTCCCTGAAATCCTGTGCCCTGG + Intergenic
1124137487 15:27048058-27048080 CCTCCAGACTCCCTGAGCCATGG - Intronic
1124654669 15:31498701-31498723 CTCCCTGACAACCTGAGCCTTGG - Intronic
1125933571 15:43616592-43616614 CTCCTTCACTGCCTGAGCACGGG - Exonic
1125946669 15:43716054-43716076 CTCCTTCACTGCCTGAGCACGGG - Intergenic
1126403624 15:48300449-48300471 CACCCTGAGACCCTGACCCCTGG + Intronic
1129261690 15:74372110-74372132 ATCCCTGACTACATAAGCCCTGG - Intergenic
1129608559 15:77036616-77036638 TTCCCTGCCTCCCCGAGCCCTGG - Intronic
1130974500 15:88762801-88762823 CTCTCTGACTCTCAGTGCCCTGG - Intergenic
1131291431 15:91110468-91110490 CTGCCTGGCTCCCAGAGCCCAGG + Intronic
1131335425 15:91544435-91544457 CTCACTACCACCCTGAGCCCTGG - Intergenic
1131343648 15:91626692-91626714 CTCCATGACTCCCTCAGCTAAGG + Intergenic
1131839478 15:96420728-96420750 CTTCCTGGCTCCCTGAGCCTCGG + Intergenic
1132415190 15:101614361-101614383 CTGCCTGGCTCCCTGGGCTCTGG - Intergenic
1132543472 16:522294-522316 CACCCTGCCTCTCTGTGCCCAGG + Exonic
1132653415 16:1031578-1031600 CTCCCTGCCCTGCTGAGCCCTGG - Intergenic
1132726219 16:1339413-1339435 CCTCCTGTCTGCCTGAGCCCAGG - Intronic
1132863331 16:2082095-2082117 CTCCCTCCCTGCCTGGGCCCAGG + Intronic
1132896211 16:2230525-2230547 CTCCCCGCCTGCCTCAGCCCCGG - Intronic
1133038508 16:3047307-3047329 CTCCCAGGCACCCAGAGCCCAGG - Intronic
1133862619 16:9610421-9610443 CTTCCTGCCTCTCTGAGCTCTGG - Intergenic
1134234604 16:12455462-12455484 CACTCTGGCTCCCAGAGCCCTGG + Intronic
1136003729 16:27314369-27314391 CTCACTGACTTCCTGAGCGCAGG - Intronic
1136547828 16:30965490-30965512 AACCCTGACTCCCAGAGCCCAGG - Intronic
1138179031 16:54930221-54930243 ATCCCGGACTTCCTGCGCCCTGG + Intergenic
1139273474 16:65705072-65705094 GACCCTGCCTCCCTGAGCCCTGG - Intergenic
1139400398 16:66676882-66676904 GTCCCTGACTCTCTGGGCACTGG - Intronic
1139401743 16:66687559-66687581 CTCCCTGACACCCTGGCCCTCGG + Intronic
1140909526 16:79438707-79438729 CTCCGTCCTTCCCTGAGCCCTGG + Intergenic
1141148264 16:81547102-81547124 CTCCCTGCCTCCGGGAGCCCAGG - Intronic
1141732715 16:85833674-85833696 CTCACTGACTCCCTCACCACCGG - Intergenic
1142047834 16:87936978-87937000 CTCCATGACTTCAGGAGCCCTGG - Intergenic
1142325794 16:89413774-89413796 CTCCCTGGCACCCTCACCCCTGG - Intronic
1142503494 17:347508-347530 CTCCCTGCCACCCTGAGCTCTGG - Intronic
1144671054 17:17132739-17132761 CCACCTGCCTCCCTGACCCCAGG - Intronic
1144703048 17:17351086-17351108 CTCCTCGAGTGCCTGAGCCCAGG + Intergenic
1144824632 17:18098908-18098930 TTCCCTCAGCCCCTGAGCCCCGG + Intronic
1144944554 17:18963274-18963296 CTGCCTGACTCGCTGTGACCTGG - Intronic
1145113571 17:20187353-20187375 ATCCTTGACTCACTGAGACCAGG - Intronic
1145399166 17:22517299-22517321 CTCCCTGGCTGCCTGAACACTGG - Intergenic
1145893849 17:28439842-28439864 CTGCCTGAACCCCTGAACCCGGG - Intergenic
1147132732 17:38418765-38418787 CTCCCTGAGTCCCAGTGCTCTGG + Intergenic
1148334736 17:46833602-46833624 CTCACTCACTCCATGAGCCAGGG - Intronic
1148578636 17:48728287-48728309 CTCGCTGAAACCCTGTGCCCAGG - Exonic
1149099441 17:52886047-52886069 CTGCCTGTCTCCCTGATTCCAGG + Intronic
1149439598 17:56663545-56663567 CACACAGACTCCATGAGCCCAGG + Intergenic
1150352770 17:64458686-64458708 CTCCCTGAACCCCTCAGCCTAGG - Intronic
1150391411 17:64791783-64791805 CTCCCTCTCACCCTCAGCCCCGG + Intergenic
1150566951 17:66350321-66350343 CTCCCTGCCTGGGTGAGCCCCGG - Intronic
1150645503 17:66975259-66975281 CTTCCTGTGTCCCTGGGCCCAGG - Intronic
1150840339 17:68600865-68600887 CCCGCTGACTCCGAGAGCCCCGG - Exonic
1151656672 17:75499478-75499500 CCCGCTGTCTTCCTGAGCCCTGG + Exonic
1151781155 17:76246404-76246426 ATCCCTGGCTCCCTGTGCACTGG + Intergenic
1152000831 17:77644502-77644524 CTCCTTAAATCCCTGAACCCAGG - Intergenic
1152137260 17:78511936-78511958 CTCCCAGACACCCAGATCCCTGG + Intronic
1152379156 17:79933496-79933518 CTCCCTTCCTCCCCGTGCCCAGG - Exonic
1152942987 17:83182160-83182182 CACGCTGACACCCGGAGCCCAGG - Intergenic
1153676607 18:7461371-7461393 CTCCCTTCCTGCCTGAGCACAGG - Intergenic
1155241598 18:23868682-23868704 CTCCCTCAGTGCCTGAGACCTGG + Intronic
1155931796 18:31716288-31716310 CTCTCAGACTCCTTGATCCCTGG - Intergenic
1157559537 18:48636837-48636859 CTCCCTAACTCCCTGCCCACAGG + Intronic
1157950382 18:52029904-52029926 TTCCCTGACCCCCTGACCCAGGG - Intergenic
1159883049 18:73877926-73877948 CTCGAAGACTCCTTGAGCCCTGG - Intergenic
1160501739 18:79404765-79404787 CTCCCTCACTCGCTGTGCGCAGG - Intronic
1160745478 19:709187-709209 CTCCCCGGCTCCCGGAGCTCCGG - Intronic
1161014368 19:1976330-1976352 CTCCCTGCAGCCCTGAGCCCGGG - Intronic
1161031934 19:2061561-2061583 CTCCCTCGCCCTCTGAGCCCGGG - Intergenic
1161171980 19:2816645-2816667 CTCCCTGACCTCCTGAGCTGAGG - Intergenic
1161219597 19:3112382-3112404 CCCCGTGGCTCCCAGAGCCCAGG + Intronic
1161329541 19:3679687-3679709 CTCACTGTGTGCCTGAGCCCAGG - Intronic
1161749328 19:6083030-6083052 TGCCCGTACTCCCTGAGCCCAGG - Intronic
1161864667 19:6825244-6825266 CTTCCTGGCCCCCTGAGCCCTGG + Intronic
1162095152 19:8305884-8305906 CTCCCTGCTGACCTGAGCCCGGG - Intronic
1162110630 19:8397888-8397910 CCCCCTAACTCCCTGGGACCAGG + Intronic
1162361388 19:10222650-10222672 CTCCCCGTCTCTCTGAGGCCCGG - Intronic
1162543225 19:11311062-11311084 CTGGCAGATTCCCTGAGCCCAGG - Intronic
1163032931 19:14556146-14556168 CTCCCTGACTCACTCTGCTCAGG + Intronic
1163207714 19:15815709-15815731 CTCCCTGACTCCCTGCCCACCGG + Intergenic
1163678088 19:18665580-18665602 CTCCCTGTCTCCCTGAGCTGTGG + Intronic
1164608882 19:29618794-29618816 CCTCCTGCCTGCCTGAGCCCAGG - Intergenic
1165256504 19:34579791-34579813 CTACATGACTCCCTGGACCCTGG - Intergenic
1165438824 19:35812325-35812347 CTCCCAGCCTCCCTGGGCCCTGG + Intronic
1166315308 19:41986024-41986046 CTCCCAGACTCCCTCTGCCTGGG + Intronic
1166746819 19:45145656-45145678 CCCACGGACTCCCTGGGCCCTGG + Exonic
1167079009 19:47266581-47266603 CACCCTGACTCCCTGTGGGCTGG + Intronic
1167174657 19:47857512-47857534 CCCCTTGACTCCCAAAGCCCTGG + Intergenic
1167504066 19:49862237-49862259 CTCTCTGCCTCCCCGAGTCCAGG - Exonic
1168345580 19:55648812-55648834 GCCCCTGACTCCAGGAGCCCAGG + Exonic
1168406591 19:56113682-56113704 CTCCCTGCCTCCCTGCGTCCCGG - Intronic
925208416 2:2026678-2026700 CTGCCTGCCTCCCCGAGGCCCGG + Intronic
925542325 2:4979304-4979326 CTTCCTGCTTCTCTGAGCCCAGG + Intergenic
925909317 2:8562994-8563016 CTCCCTGTTTCCCTGTCCCCCGG - Intergenic
926059199 2:9794628-9794650 CACCCTGACACCCTCACCCCTGG + Intergenic
926150169 2:10421388-10421410 CTGAGTGCCTCCCTGAGCCCAGG + Intronic
926163400 2:10503457-10503479 TTCCCAGACCCCCAGAGCCCTGG - Intergenic
927509376 2:23634934-23634956 CTCCATGACTCCATGAGGGCAGG - Intronic
927909173 2:26884386-26884408 TTGGCTGACTCCCTGAGGCCAGG - Intronic
928359484 2:30651510-30651532 CTCCCTGTCTTTCAGAGCCCCGG - Intergenic
928456337 2:31426276-31426298 CCCCCCGGGTCCCTGAGCCCAGG + Intergenic
928482205 2:31694019-31694041 CTCCTTGGTTCTCTGAGCCCTGG + Intergenic
928939631 2:36714676-36714698 CTCCCTTATTGCCTGTGCCCAGG + Intronic
929017453 2:37513093-37513115 CTGCATGACTCTCTGGGCCCAGG + Intergenic
931945431 2:67301064-67301086 CTCCCTGTCTCCCAGCTCCCAGG + Intergenic
932458257 2:71863777-71863799 CTTCCTGCCTCCCTGAACCTGGG + Intergenic
932595352 2:73089790-73089812 CTCCCAGCCACCGTGAGCCCAGG + Intronic
932781571 2:74561803-74561825 TCCCCTGCCTCCCTGTGCCCTGG + Intronic
932812229 2:74834866-74834888 CGCCCTCCCTCCCTGAGCTCCGG + Intronic
934678317 2:96265550-96265572 CTCCCCGTCTCCGTCAGCCCCGG - Intronic
935332102 2:101984941-101984963 GTCCCTCACTCCCTGACCCAGGG + Intergenic
935419378 2:102851488-102851510 CTCCTTGACCTCCTAAGCCCTGG - Intergenic
935556061 2:104510625-104510647 CTCCCCGCTTCCCTGACCCCCGG - Intergenic
937349122 2:121149110-121149132 CTCCCTGTGTCCCTGACCCCTGG - Intergenic
938481717 2:131668542-131668564 CTCACTGTCTCACTGAGCTCAGG - Intergenic
939419001 2:141941631-141941653 CTCCCAGGTTCCCTGAGCTCTGG - Intronic
945198069 2:207255938-207255960 CTGCCCGACTCCCTGAGGCATGG + Intergenic
945493652 2:210484125-210484147 CTCCCTGACTGCCTCAGGTCAGG - Intronic
945999143 2:216466121-216466143 CTCCCTTGCTCCCTCAGCTCAGG + Intronic
946038956 2:216767273-216767295 ATGCCCGACTCCCTGATCCCTGG - Intergenic
946246431 2:218390454-218390476 CTCCCTGACTCTCTGGGATCTGG + Intronic
946326380 2:218986582-218986604 CTCTCTCACTGCTTGAGCCCAGG + Intergenic
946735356 2:222748662-222748684 TTCCCTCACTCCCTAATCCCTGG + Intergenic
947219506 2:227779031-227779053 CTCCCTGAGTCTTTTAGCCCCGG - Intergenic
948493851 2:238332474-238332496 CTCCCTCACTTCCAGATCCCTGG + Intronic
948567735 2:238897342-238897364 CTCCGTGGCTCCCCCAGCCCTGG - Intronic
948708272 2:239809330-239809352 CTCCCTGTGTCCTGGAGCCCAGG + Intergenic
948746055 2:240095307-240095329 CTCCTGCACTCCCAGAGCCCAGG + Intergenic
1171150416 20:22822406-22822428 CTCCCTTCCTCACTGGGCCCAGG - Intergenic
1171484480 20:25477212-25477234 CTCCTCGCCTCCCTCAGCCCTGG + Intronic
1171969117 20:31552323-31552345 CTCCCTGATTCTCTGCTCCCAGG - Intronic
1172649434 20:36492461-36492483 CCCTCAGACGCCCTGAGCCCTGG - Intronic
1172748419 20:37231768-37231790 ATCCCTCTCTCCCTGAGCCATGG - Intronic
1172775138 20:37402909-37402931 GTCCCTGAATCCCTCTGCCCTGG + Intronic
1173121167 20:40290712-40290734 CTCCATGGCTCCCTGACTCCAGG + Intergenic
1173827701 20:46058012-46058034 CTCCCTGGCTCCCGGCGGCCCGG + Intronic
1173872545 20:46351011-46351033 CTCTCTGCCTGCCTGGGCCCAGG - Intronic
1174216449 20:48920266-48920288 TCCCCTGACTCCCAAAGCCCAGG + Intergenic
1174528747 20:51194185-51194207 CTCCCTGTCTCCGTGGGACCTGG - Intergenic
1175257423 20:57655704-57655726 CTCCCAGACTCCCAGGGCTCGGG + Intronic
1175852905 20:62103571-62103593 CACCCTAACTCCCTCGGCCCAGG - Intergenic
1176147934 20:63573741-63573763 CTTCCTGGCACCCTGAGCTCTGG - Intronic
1176195710 20:63835689-63835711 CCCCCTCCCTTCCTGAGCCCTGG + Intergenic
1179151951 21:38816545-38816567 ATCCCAGACTCCCACAGCCCTGG + Intronic
1179176734 21:39013352-39013374 CTCCCTCACTCCCTGTGCACTGG - Intergenic
1180109408 21:45641140-45641162 TTTCCTGCCTCCCTGAGCTCGGG - Intergenic
1180143500 21:45907084-45907106 CTCCCTCACTGCCTGGACCCAGG + Intronic
1180482930 22:15772134-15772156 CTCACTGTCTCACTGAGCTCAGG - Intergenic
1180986114 22:19904705-19904727 CTCCCTGTCCCCCTGGCCCCAGG - Intronic
1181534020 22:23532550-23532572 CTCTCTGGGTCTCTGAGCCCCGG + Intergenic
1181638225 22:24184082-24184104 CTCCCTGCTTCCCTGGGCCCAGG + Intronic
1181795165 22:25302922-25302944 CTCCCCCAATCCCTGAGACCAGG - Intergenic
1182253477 22:29020676-29020698 CTGCCTGCCTCCCAGAGTCCAGG + Intronic
1182282440 22:29225247-29225269 CTCCAGGGCTCCCTCAGCCCAGG - Intronic
1182414893 22:30215061-30215083 CCCAAAGACTCCCTGAGCCCTGG - Intergenic
1182418785 22:30238524-30238546 CTCCCTGCCTCTCTCAGCCTGGG - Intergenic
1182486725 22:30643548-30643570 CTGGCTGACACCCTGTGCCCTGG - Intronic
1182549696 22:31094103-31094125 CTCCCTGCCGCCCTGCACCCTGG + Intronic
1183342087 22:37287053-37287075 CTTCCTGAATTCCTGAGCTCTGG - Intronic
1183469081 22:37996284-37996306 TTCCCTGCCTCCCTGGGCTCAGG - Intronic
1183624404 22:38992925-38992947 CACCCTCACTCACAGAGCCCCGG + Intergenic
1184043178 22:41956577-41956599 CTCCTTGTGCCCCTGAGCCCCGG - Intergenic
1184084119 22:42248187-42248209 TTCCCTGCCCACCTGAGCCCAGG - Intronic
1184538955 22:45107155-45107177 CTCCCTGGCTCCATCAGCTCAGG - Intergenic
1184751561 22:46489274-46489296 CTCCCTGCCCCACTGAGCCAGGG - Intronic
1185115356 22:48931683-48931705 CTGCCTGACCCCCTGAGCTGAGG - Intergenic
1185128558 22:49025016-49025038 CTCCCTCCCTGGCTGAGCCCTGG + Intergenic
1185137647 22:49081672-49081694 CTCCCGGATCCCCTGAGCACAGG - Intergenic
1185179461 22:49350687-49350709 CTCCCTGCCTCCCTAAGACCTGG + Intergenic
1185280399 22:49967376-49967398 CTCCCCGACTCCCCGGGGCCCGG + Intergenic
949916588 3:8969051-8969073 TTGCTTGGCTCCCTGAGCCCTGG - Intergenic
950231366 3:11278873-11278895 TTCCCTGACTCCCTCAGCTCTGG - Intronic
950366093 3:12485126-12485148 ATCCTTGCCTCCCTAAGCCCAGG + Intronic
950469914 3:13178132-13178154 CTCCCAGACTACCCGAGTCCCGG + Intergenic
950552827 3:13677011-13677033 TGCCCTAACTCCCAGAGCCCAGG - Intergenic
950909843 3:16577141-16577163 ATCCCAGACTCTCTGAGGCCAGG - Intergenic
951308739 3:21098516-21098538 CTCACTGAGACCCTGAGCTCTGG + Intergenic
951313959 3:21165384-21165406 CTTCCTGACTTCCAGATCCCAGG + Intergenic
952809755 3:37391277-37391299 CTCCCTGTGTCCCTGCTCCCTGG - Intronic
952862335 3:37823704-37823726 CACCCTGACTCCCCTGGCCCAGG + Intergenic
953079419 3:39601697-39601719 CACCCTGCCACCATGAGCCCAGG + Intergenic
953916134 3:46922311-46922333 CTCCCTGCCTCCCTGCTCCAGGG - Exonic
954257979 3:49419405-49419427 GTCACTGGCTCCCTGGGCCCAGG - Exonic
954373152 3:50180237-50180259 CCCCCCGACTCCCTGCTCCCCGG + Intronic
954428189 3:50454595-50454617 GTCCCAGAATCCCTCAGCCCGGG + Intronic
955411531 3:58658592-58658614 TTCCCTGACTCTCTGAGTCAAGG + Intronic
956455389 3:69415622-69415644 GTCCCTGATTCCCTCAGCCTAGG + Intronic
957169532 3:76720155-76720177 CTCCCTCACTCCTTCAGCCATGG + Intronic
959933437 3:112006336-112006358 CTCCCTGACTCCCACTGCTCTGG - Intronic
961513912 3:127421054-127421076 CTGTCTGACTCCAAGAGCCCTGG + Intergenic
962282857 3:134065415-134065437 GTCACAGAGTCCCTGAGCCCTGG + Intronic
962811609 3:138963246-138963268 GGCCCTGACTCCCTGACGCCTGG - Intergenic
963091646 3:141487727-141487749 CTCCCAGGCTCGCCGAGCCCAGG - Intronic
963235761 3:142953989-142954011 CTCCCTTCCTTCCTGAGGCCTGG + Intronic
963755327 3:149229031-149229053 CTCCCAGACTCCTTGGTCCCTGG + Intergenic
964426002 3:156554808-156554830 CTCCGTGCCTCCCCGAGCTCAGG + Intronic
964616555 3:158672658-158672680 CTCCCTGCATCCGAGAGCCCTGG + Exonic
967398990 3:189040080-189040102 CTCCCTGACACCCTAGGGCCAGG + Intronic
967476191 3:189923122-189923144 CTCCCTCTCTCACTGAGTCCTGG - Intergenic
967964483 3:194950228-194950250 CTCCCTGTCTTCCAGAGCCTCGG - Intergenic
968075275 3:195812734-195812756 GTCCCTGGCTCCCTGCACCCTGG - Intergenic
968921802 4:3526060-3526082 CACCCTGTCTCCGTGAACCCTGG - Intronic
968987064 4:3881206-3881228 CTGCCTGAGTCCTGGAGCCCCGG + Intergenic
969098477 4:4751733-4751755 CTCCATGACGCCCTGGGGCCGGG - Intergenic
969155384 4:5205457-5205479 CTCCCTGTCTCTGTGTGCCCTGG - Intronic
969529733 4:7724005-7724027 CTCCCTGCCTCCCTGCCCTCGGG - Intronic
969533900 4:7744309-7744331 CTCACTTCCTCCCTGAGTCCTGG - Intergenic
969643231 4:8411679-8411701 CTGGCTGCCTCCCTGCGCCCCGG + Intronic
970226322 4:13861000-13861022 CTCTCTGACTTCCTGTGCCCAGG + Intergenic
971286047 4:25291002-25291024 CTCCCCGCCTCCCTGCACCCCGG + Intergenic
973710217 4:53622492-53622514 CTCCCTCACTCTCTCACCCCAGG + Intronic
974741686 4:66014708-66014730 CTCACTGCCTCCCTTGGCCCAGG + Intergenic
975267839 4:72392170-72392192 TTCCCTGACTCCTGGAGACCAGG + Intronic
977920085 4:102633473-102633495 CTCCCTGTCTCCCTGAAGCCAGG - Intronic
979649029 4:123107814-123107836 CTCAGTGTCTCCCTGAGCACAGG + Intronic
980718264 4:136657066-136657088 CTGGTTGACTGCCTGAGCCCAGG - Intergenic
981675802 4:147341612-147341634 CCCCCTGACTCAGAGAGCCCAGG - Intergenic
982037087 4:151356239-151356261 GTCCCAGACTCCCTGACCACAGG - Intergenic
982124598 4:152173870-152173892 CACTCTAAATCCCTGAGCCCTGG - Intergenic
982287688 4:153752404-153752426 CTCCATGGCTCCCTGCCCCCAGG - Intronic
984472974 4:180200725-180200747 TCCCTTGATTCCCTGAGCCCAGG - Intergenic
984490683 4:180431069-180431091 CGCCCTTACTCCCTGTGCTCAGG + Intergenic
984918937 4:184747344-184747366 TTCCCTGATTCTCTAAGCCCTGG - Intergenic
985008983 4:185562934-185562956 ATCCTTGACCTCCTGAGCCCAGG - Intergenic
985673156 5:1216738-1216760 CTCCCAGCCTCCCTGGCCCCAGG + Intronic
985758607 5:1733472-1733494 CTCCCTGACCCCCAGGGCCCTGG + Intergenic
985767570 5:1787873-1787895 CTCCCTGACACCCTGTGGCCCGG + Intergenic
985995384 5:3594710-3594732 CTCCTCGCCTCCCTGAGCCTGGG - Intergenic
986901823 5:12444218-12444240 CTCCTTCACTCCCTGTGCACAGG + Intergenic
987054389 5:14177643-14177665 CTCGCTGGGTCCCAGAGCCCAGG + Intronic
988529665 5:32016639-32016661 CTCACAGTCTCTCTGAGCCCAGG + Intronic
990310274 5:54531103-54531125 CACCCTGGCTCCCTGAGGCAGGG + Intronic
990622282 5:57573070-57573092 CTCCTTGACTCCCCCAGCCCTGG + Intergenic
991359885 5:65808372-65808394 CTCCCTGACTTCATCATCCCTGG - Intronic
991676606 5:69094458-69094480 CTGCCTGCCTCCCTGCGCGCAGG + Intronic
992162965 5:74020402-74020424 CTTACTGACTCCCTGAAGCCTGG - Intergenic
992821527 5:80502167-80502189 CTCACAGATTACCTGAGCCCAGG - Intronic
993957095 5:94247535-94247557 TTTCCTGACTCCCTGAGACCAGG + Intronic
995581489 5:113607280-113607302 CTCCCTAGTTCCCTGAGCCCTGG - Intergenic
997197333 5:131988831-131988853 CTCTATGACACCCTGGGCCCTGG - Exonic
997658852 5:135575036-135575058 CTCCCAGCCTCTCTGAGCCTGGG + Intronic
998381659 5:141730206-141730228 ATCCCTGAGTCCCTGTGGCCTGG + Intergenic
998444389 5:142187302-142187324 CTCCCTGACTGCTCTAGCCCAGG + Intergenic
998820785 5:146055994-146056016 TTTCCAGACTCCCGGAGCCCTGG + Exonic
1000053300 5:157580638-157580660 CCTCCTGTCTTCCTGAGCCCTGG + Intergenic
1000063397 5:157675391-157675413 CTCTCTGGCTCCCTTAGCCCAGG - Intronic
1001523963 5:172415425-172415447 CTCCCTGCCTCCTTGGGCCCCGG - Intronic
1001681922 5:173564236-173564258 CTTCCTGTAGCCCTGAGCCCTGG - Intergenic
1001745579 5:174089941-174089963 CTTCCTGCCTCCCAGAGCCCAGG - Intronic
1001946587 5:175783903-175783925 CTGCCTGACTGCTTGAGCTCAGG - Intergenic
1003824361 6:9936638-9936660 CTCCCTGCGTCCCTCAGCCATGG - Intronic
1004550899 6:16646138-16646160 ATCCTTGACCTCCTGAGCCCAGG - Intronic
1004614802 6:17280521-17280543 CTCCTTGACCCCCCGCGCCCGGG + Intergenic
1005465260 6:26106837-26106859 CTCCCTTAGTCCCTGCACCCAGG - Intergenic
1005578244 6:27210103-27210125 CTCAGTGAACCCCTGAGCCCCGG + Intergenic
1005905455 6:30259291-30259313 CACACTGACTGCCTGAGTCCTGG - Intergenic
1006151515 6:31992592-31992614 CCCCCTGCTTCCCTGAGCCTTGG + Intronic
1006157816 6:32025330-32025352 CCCCCTGCTTCCCTGAGCCTTGG + Intronic
1006273036 6:32978813-32978835 CACCCTGACTCCCAAAGCCAGGG - Intronic
1006639389 6:35481488-35481510 CACACTGCCTCACTGAGCCCAGG + Intronic
1007357575 6:41332596-41332618 TTCCTGCACTCCCTGAGCCCAGG + Intergenic
1007593534 6:43037797-43037819 CACACTGAGTCCCTGAACCCAGG - Exonic
1007687662 6:43676612-43676634 TTCCCAGACTGCTTGAGCCCAGG + Intronic
1007690790 6:43699843-43699865 CTGGCAGACTCCCTGAGCCTGGG + Intergenic
1007818463 6:44541880-44541902 CTCCCTCTCTCCCTGGGCCTTGG - Intergenic
1010811149 6:80300131-80300153 ATCCTTGACTTCCAGAGCCCAGG + Intronic
1012090841 6:94894549-94894571 TTCCCTTACTCCCTAGGCCCAGG + Intergenic
1012720607 6:102737624-102737646 CTCCCTTACTCCTTCATCCCGGG - Intergenic
1016016145 6:139188255-139188277 CTCACTGCCTCACTGAGGCCTGG - Intergenic
1016040896 6:139431117-139431139 CTCCCTGCCTCCTGGAGGCCAGG + Intergenic
1016439137 6:144065319-144065341 TTACGTGACTCCCTGAGCCTCGG - Intergenic
1017060363 6:150478773-150478795 CTCCATGATTATCTGAGCCCAGG + Intergenic
1017821110 6:158049629-158049651 CAGCCTGAGGCCCTGAGCCCAGG + Intronic
1017890219 6:158631636-158631658 CTCCCTGACCCCCAGTTCCCAGG - Intronic
1017971339 6:159315165-159315187 GCCCCTGCCTCCCTGAGCTCAGG + Intergenic
1018124244 6:160666508-160666530 CTGCCAGACTCTCTGAACCCTGG + Intergenic
1018857597 6:167685724-167685746 AGCCCTCCCTCCCTGAGCCCTGG - Intergenic
1019127914 6:169853601-169853623 CTCCCACACCCCCTGAGCTCGGG + Intergenic
1019210597 6:170401512-170401534 CTCCCTCCCTCCCTGCTCCCTGG - Intronic
1021786688 7:24159320-24159342 CTTCATGCCTCCCTGAGTCCCGG - Intergenic
1022383964 7:29884695-29884717 CTCTCTGCCTCCCTCACCCCTGG - Intronic
1023537133 7:41225459-41225481 CTACCTGCCTCACTGTGCCCTGG - Intergenic
1023822129 7:43986273-43986295 GTCCCTGGCCCCCAGAGCCCGGG - Intergenic
1024183906 7:46928264-46928286 CTGCCTGCTCCCCTGAGCCCTGG + Intergenic
1024234190 7:47385482-47385504 CTCCCTGCCTCTCTGAGCATCGG - Intronic
1024264787 7:47598242-47598264 CACCCTTTATCCCTGAGCCCCGG - Intergenic
1024733388 7:52276826-52276848 CTCCCTGACTCTCTGAAAGCAGG - Intergenic
1025901968 7:65751694-65751716 ATCCCTGGCTCCCTGAGATCTGG + Intergenic
1029364398 7:100107662-100107684 CTCCCTGCCCCCCAGAGGCCTGG + Intronic
1029659307 7:101948789-101948811 CTGCCTGAGTCCCTGAGCTTGGG + Intronic
1032520365 7:132539144-132539166 CTCCCTGTGTCCCACAGCCCTGG - Intronic
1032842797 7:135727354-135727376 CCCACTGACTCCCAGACCCCCGG + Intronic
1035153499 7:156893612-156893634 CTCCCTGCTTCCCTCTGCCCAGG - Intergenic
1035375608 7:158404913-158404935 CTCCCTGGCTCCCAGCTCCCCGG + Intronic
1035580787 8:738079-738101 CTCCCGCACCCCCGGAGCCCAGG - Intronic
1038079731 8:24120320-24120342 CTGCCTGACTCCTTGAGCTGCGG + Intergenic
1038345107 8:26725411-26725433 CTCCCTGGCTCTCCGAGTCCTGG + Intergenic
1038496698 8:28008414-28008436 CTCCCTGCCTCCCAGAGGCATGG + Intergenic
1038905322 8:31895723-31895745 CTCTCTGAGTCCCTGACCCTTGG + Intronic
1040299704 8:46181507-46181529 CCCCCTGAGTCCCTGTGGCCCGG + Intergenic
1040305226 8:46208525-46208547 CTCCCTGAGTCCCTGAGGCTTGG - Intergenic
1041857723 8:62477407-62477429 TTCCCTCATTGCCTGAGCCCTGG - Intronic
1044785386 8:95787494-95787516 CTTCCTAAATCCCCGAGCCCTGG - Intergenic
1045354144 8:101370284-101370306 CTTCCTGACTCCCAGAGCACTGG - Intergenic
1046739863 8:117816486-117816508 TTCCCTGACTCTCAGTGCCCTGG - Intronic
1048211297 8:132456445-132456467 CACCCTCAATCCCCGAGCCCTGG - Intronic
1049018779 8:139939829-139939851 CTCCCTCTCTTCCTGGGCCCTGG - Intronic
1049312089 8:141938660-141938682 CACCCCGACTCCCAGGGCCCTGG + Intergenic
1049392097 8:142376928-142376950 TTCCCTCTCTTCCTGAGCCCAGG - Intronic
1049475669 8:142795951-142795973 TTCCCTGACTCCTTTATCCCTGG - Intergenic
1049480040 8:142818278-142818300 CTCCGCGGCTCCCTGGGCCCGGG - Intergenic
1049487527 8:142874311-142874333 CTCCCTTTCTGCCTGACCCCAGG - Exonic
1049687418 8:143944492-143944514 CACCCAGACCCCCTCAGCCCTGG - Intronic
1049779822 8:144423798-144423820 CTTCCTGCATGCCTGAGCCCGGG - Exonic
1050274367 9:3981494-3981516 CTCCCTGACCCCATGAGTCCGGG + Intronic
1051260434 9:15258647-15258669 CTCTCTGACTTTCTCAGCCCTGG - Intronic
1051517906 9:17951177-17951199 CTCCATGATGCCCTGTGCCCCGG - Intergenic
1052020283 9:23517956-23517978 CTCTCTGCACCCCTGAGCCCTGG - Intergenic
1052259760 9:26500524-26500546 CTCCCTAACTCCCTCCACCCTGG - Intergenic
1053092352 9:35290458-35290480 CTCCCAGACTCCCTTACCCATGG - Intronic
1054076961 9:60546029-60546051 CTACCTGACTTGCTGAGGCCGGG - Intergenic
1054905720 9:70412651-70412673 CTCCGTGGCTCCCGGAGGCCGGG + Intronic
1054914164 9:70480464-70480486 CTGCCTCCCTCCCTAAGCCCGGG + Intergenic
1056427052 9:86488180-86488202 CTCACTGATTCCCTGCCCCCAGG + Intergenic
1056543349 9:87593050-87593072 CTCACTGCCTCCCTGAGACCTGG + Intronic
1056877420 9:90347840-90347862 ATCTCTAATTCCCTGAGCCCAGG - Intergenic
1056991924 9:91421258-91421280 CTCCCTGGCTCCCGCGGCCCGGG + Intronic
1057299737 9:93870929-93870951 CTCCCTGGCTCCCTCTCCCCCGG + Intergenic
1057519848 9:95751975-95751997 CTCCCTCCCTCCCGGAGCTCAGG - Intergenic
1057538172 9:95936779-95936801 TCCCCTTTCTCCCTGAGCCCTGG + Intronic
1058949828 9:109893103-109893125 CTCCCTGCCTTCCTCTGCCCTGG - Intronic
1058979938 9:110159845-110159867 CTCCCTGACTCCCATAAGCCAGG - Intronic
1059430620 9:114248170-114248192 CTCTCCGACCTCCTGAGCCCTGG + Intronic
1059964403 9:119599681-119599703 CTACCTGCCTCCCTGAGCCTGGG + Intergenic
1060171771 9:121467691-121467713 CTTCCTGAATTCCTAAGCCCTGG - Intergenic
1060296561 9:122347258-122347280 CTCGCCGCCTCCCTGAGCCTGGG + Intergenic
1060551245 9:124486374-124486396 GGCCCTGGTTCCCTGAGCCCTGG - Intronic
1061247649 9:129409145-129409167 ATCCCAGACTCCCAGAGGCCTGG + Intergenic
1061617047 9:131787211-131787233 CTCCGTGTCTGCCTGATCCCGGG - Intergenic
1061798578 9:133102390-133102412 CTCCCTGACTCCCTGAGCCCAGG + Intronic
1061892321 9:133629377-133629399 TGCCCTGACTCCCTGGGCCTTGG - Intergenic
1061903835 9:133686433-133686455 CTCCCTGACTCCCTAGGTCTTGG + Intronic
1061912879 9:133734181-133734203 CTCCCTGTTTCGCTGAGGCCTGG - Exonic
1061991041 9:134158955-134158977 CTCCCTGAGTCCCTTACTCCAGG + Exonic
1062048036 9:134433393-134433415 CTCCCTGCATGCCTGTGCCCTGG - Intronic
1203734993 Un_GL000216v2:128930-128952 GTTCCTCACTCCCTGACCCCTGG + Intergenic
1187821534 X:23293204-23293226 TTCCCTGCCACCCTGGGCCCTGG + Intergenic
1189294903 X:39911061-39911083 CTGCCTGACTCCCTCTTCCCTGG + Intergenic
1189373688 X:40449617-40449639 CTCCAGCACTCTCTGAGCCCTGG - Intergenic
1190263784 X:48815758-48815780 CTCTCTCTCTCCCTGGGCCCTGG + Intronic
1190390889 X:49930554-49930576 CTCCCCCACTCCCTGACCCCTGG - Intronic
1191253538 X:58270339-58270361 CTCCATGACCCCCTTGGCCCTGG + Intergenic
1194313791 X:92348369-92348391 CTATCTGACTCCCCAAGCCCAGG + Intronic
1196050830 X:111302116-111302138 CTCCCCTCTTCCCTGAGCCCTGG + Intronic
1196855173 X:119975964-119975986 AACCTTGACTCCCTGGGCCCAGG + Intergenic
1200134604 X:153868781-153868803 CTCCCTGGCTCCCTGGCCACTGG + Intronic
1200622060 Y:5462484-5462506 CTATCTGACTCCCCAAGCCCAGG + Intronic
1202626038 Y:56859618-56859640 GTTCCTCACTCCCTGACCCCTGG - Intergenic