ID: 1061798586

View in Genome Browser
Species Human (GRCh38)
Location 9:133102419-133102441
Sequence CCTTGGGGCTCAGAAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061798586_1061798591 -1 Left 1061798586 9:133102419-133102441 CCTGAAGCTTCTGAGCCCCAAGG 0: 1
1: 0
2: 3
3: 30
4: 226
Right 1061798591 9:133102441-133102463 GCAGCTGCCCCTACCACCCTTGG 0: 1
1: 0
2: 5
3: 31
4: 285
1061798586_1061798592 4 Left 1061798586 9:133102419-133102441 CCTGAAGCTTCTGAGCCCCAAGG 0: 1
1: 0
2: 3
3: 30
4: 226
Right 1061798592 9:133102446-133102468 TGCCCCTACCACCCTTGGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061798586 Original CRISPR CCTTGGGGCTCAGAAGCTTC AGG (reversed) Intronic
900398736 1:2464149-2464171 CTCTGGGGCTCAGAAGCAGCTGG + Intronic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
902637353 1:17743345-17743367 GCTGGGAGCTCAGAAGCTGCTGG + Intergenic
902711341 1:18242008-18242030 CCTGGGGGCAGAGGAGCTTCTGG + Intronic
903481678 1:23657902-23657924 CCAGGGGGCTCAGAAGCTCTGGG + Intergenic
903762108 1:25706111-25706133 CCTTTTGCATCAGAAGCTTCTGG - Intronic
905000600 1:34665310-34665332 CTTTGGGGCTCTGAGGCTCCAGG + Intergenic
906082253 1:43101093-43101115 CCATGGGCCACAGAGGCTTCTGG - Intergenic
906458594 1:46019951-46019973 TCTTGGGGGTGAGAAGCGTCAGG + Intronic
906892334 1:49730564-49730586 CCTTGGGGCTCTGCAGTTGCTGG + Intronic
907424772 1:54372708-54372730 CCTGAGGGCTCAGGAGCATCAGG + Intronic
907654525 1:56328778-56328800 CCTTGGGGCTCTTAAGCTCTCGG + Intergenic
913239365 1:116816542-116816564 CCTCAAGGCTCAGAAACTTCCGG - Intergenic
913397122 1:118384013-118384035 CCTTTGAGCTCAGAAGGTTGAGG - Intergenic
915873490 1:159587476-159587498 CTGTGTGGCTCAGGAGCTTCTGG + Intergenic
915973624 1:160370902-160370924 CCTCGCGGCTCAGATGCTGCAGG - Exonic
918061149 1:181062370-181062392 CTTAGGGACTCAGAACCTTCTGG - Intergenic
920648363 1:207819290-207819312 CCGTGGGACTCAGCAGCGTCAGG + Intergenic
922414527 1:225408469-225408491 CCTTGGGGCTCAGGAGCTGGTGG - Intronic
922892106 1:229070038-229070060 CCTGGGGGATCAGAAACTCCTGG + Intergenic
923703918 1:236327688-236327710 CCTTTGGGCCCAGCAGCTTAAGG - Intergenic
923786095 1:237070880-237070902 CCTTGGGGCTCTGCAGTTCCTGG - Intronic
1063644439 10:7865126-7865148 GCCTGGGGGTCAGGAGCTTCAGG + Intronic
1064006672 10:11704445-11704467 CTTTGCAGCTCAGAAGATTCTGG - Intergenic
1065307560 10:24383429-24383451 CCTTGGGGCAGAGAGGCTGCAGG + Intronic
1066489679 10:35882758-35882780 CCTTGGGGAGCACAAGCATCTGG - Intergenic
1067712863 10:48664228-48664250 TGCTGGGGCTCAGAAGCTTTTGG + Intergenic
1068130585 10:52890277-52890299 CTTTGGGGCTCAGCAGTTCCTGG + Intergenic
1069752522 10:70753416-70753438 CCTGGGTGCTGAGAAGCGTCAGG - Intronic
1071666517 10:87564020-87564042 CCCTGGGGCTCAGCAGCTCCAGG + Intergenic
1071837482 10:89433034-89433056 CCTTGAGCCCCAGAATCTTCAGG - Exonic
1074871980 10:117584170-117584192 CCTGGGAGCAGAGAAGCTTCTGG + Intergenic
1075085277 10:119410551-119410573 CCTTGGGGCTGCAAAGCGTCGGG - Intronic
1075850176 10:125580575-125580597 CCTTCCATCTCAGAAGCTTCTGG - Intronic
1075897220 10:126007122-126007144 CCATGGGCTTCAGAAGCATCAGG - Intronic
1077938939 11:6818965-6818987 CTTTGGGGCTCTGCAGCTCCTGG + Intergenic
1078251479 11:9620154-9620176 CCCTGGGTCTCAGAGGCATCTGG + Intergenic
1081764463 11:45599816-45599838 CCATGGGGCTCGGCAGCTTTGGG - Intergenic
1083035702 11:59635473-59635495 CCTTGAGGTTCAGTAGCTTGTGG - Intergenic
1083418721 11:62541807-62541829 CCTTGGGGGTCAGAGACTCCTGG - Intronic
1083471846 11:62889308-62889330 CCTTGGGGCTCATACCCTTTGGG + Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084239963 11:67812371-67812393 TCCTGGGGCTCCGAAGCTGCTGG + Intergenic
1084653560 11:70502603-70502625 ACTTGGGGCTCACACGCTGCCGG - Intronic
1085393110 11:76192665-76192687 CCCTTGGGCTCAGAGGCTTGGGG + Intronic
1086321021 11:85647883-85647905 GCTTTGGGCTGAGAAGCTTCCGG - Intergenic
1089300615 11:117496608-117496630 CCTTGGAGCTCAGATCCATCTGG + Intronic
1090079649 11:123603419-123603441 CCTTGGGACACAGAGGCTTCAGG - Exonic
1091358183 11:134954493-134954515 CCATGGCTCTCAGGAGCTTCTGG - Intergenic
1091597748 12:1890312-1890334 CCTGGGGGCCCAACAGCTTCTGG + Intronic
1091628634 12:2141464-2141486 CCTTGTGTCCCAGAAGCTTCTGG - Intronic
1093317134 12:17666169-17666191 CTTTGGGGCTCTGAAGTTTCTGG - Intergenic
1094343895 12:29444945-29444967 TCTTGTGGCTCAGAAGATTTGGG - Intronic
1095737068 12:45569001-45569023 CCTTGGGACTCTGAAGCTTGTGG + Intergenic
1095957190 12:47813566-47813588 CCCTGGTGGTCAGAAGCTTTGGG - Intronic
1096557375 12:52411685-52411707 CCTTGGAGCTGGGAAGCTTGAGG + Intergenic
1096849124 12:54424389-54424411 CCTTTGAGCTGAGAAGATTCAGG - Intergenic
1097676216 12:62604443-62604465 CCTTGGGGCTCAGATTCTGCTGG + Intergenic
1098476257 12:70907703-70907725 CCTTGGGCCTCAGACTCTGCTGG + Intronic
1099049678 12:77767729-77767751 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1100690292 12:97032294-97032316 CTTTGGGGCTTCCAAGCTTCGGG - Intergenic
1101667330 12:106831195-106831217 CCTTAGGGCTCAGCAGCCTGTGG - Intronic
1102223134 12:111208269-111208291 CCTTGGAGCTGAGAAGATTGTGG + Intronic
1102455250 12:113066871-113066893 CCTTGGAGCCCAGGAGCTGCCGG + Intronic
1103560053 12:121788910-121788932 TCTTTGGACCCAGAAGCTTCAGG + Intronic
1104898822 12:132176899-132176921 CCTTCTGGCTCAGAAGCTCCAGG + Intergenic
1104984921 12:132591382-132591404 CCTTGGTGCGCAGAAGGTTCTGG + Intergenic
1105247510 13:18666490-18666512 TCATGGGGCTCAGAGGCTCCAGG - Intergenic
1106614141 13:31310776-31310798 CCTTGGGGCTCCGCAGTTGCTGG + Intronic
1107035857 13:35901773-35901795 CCTTGGTGTTCAGTATCTTCTGG - Intronic
1108437644 13:50416646-50416668 CCTTGGGGTCAAGAAGCATCAGG + Intronic
1108542337 13:51455857-51455879 CTTTGGGGCTCTGCAGCTCCTGG - Intergenic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1108915569 13:55606303-55606325 CCTTGGGGCTCCGCAGTTGCTGG + Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1109534820 13:63701709-63701731 CCTTGAGGTTCAGTAACTTCAGG + Intergenic
1109640133 13:65180658-65180680 CTTTGGGGATCAGAAGCAGCAGG - Intergenic
1109981264 13:69911645-69911667 CCTTAGTGCACAGAAGATTCAGG - Intronic
1110850689 13:80241413-80241435 CTTTGGGGCTCTGTAGCTCCTGG - Intergenic
1113610773 13:111643555-111643577 CCCTTGGGCTCTGAAGCTTGTGG + Intronic
1115805720 14:37049032-37049054 CCTTGTGAATCAGAAGCTACAGG + Intronic
1117545095 14:56787058-56787080 CCTTTGGACTCAGAAGTTTCTGG + Intergenic
1118976031 14:70677371-70677393 CCTTGCAGCTCAGAGGCTGCTGG - Intergenic
1119661726 14:76456980-76457002 CCTGTGGGCTCAGAGGCTGCTGG - Intronic
1121016857 14:90554213-90554235 CTTTGGGGCTCAGAAGCTGCTGG - Intronic
1121691228 14:95878179-95878201 CTTTGGGGCTCAGAAGTGTTTGG - Intergenic
1123072532 14:105648758-105648780 CAGTGGGGGTCAGAAGCTTCAGG - Intergenic
1123946788 15:25242666-25242688 CCTTGGGACTCGTAAGCTTTGGG + Intergenic
1124820966 15:33045075-33045097 CTTTGGGGCTCTGCAGTTTCTGG + Intronic
1125172191 15:36778212-36778234 CTGTGGGGGTCAGTAGCTTCAGG - Intronic
1127727403 15:61763494-61763516 CCTTGGGGCTCACATGCTGGTGG + Intergenic
1127790183 15:62391815-62391837 CCTTGGGGCTCCGAGGCTCAGGG + Intronic
1129362257 15:75031229-75031251 TCCTGGGGCTCAGGAGCTTCAGG + Intronic
1129738920 15:77980398-77980420 GCTGGGGTCTCAGAAGCTTCAGG - Intergenic
1129847036 15:78772780-78772802 GCTGGGGTCTCAGAAGCTTCAGG + Intronic
1132657907 16:1048937-1048959 CCCCGGGGCTCAGCAGCCTCAGG + Intergenic
1133818237 16:9214386-9214408 CCTTCCGGATTAGAAGCTTCAGG + Intergenic
1136274855 16:29173448-29173470 CCTTGGGGCTCTGAGCCTCCTGG - Intergenic
1138625014 16:58244641-58244663 CCTTGGGAGTGAGAAGCTTTGGG - Intronic
1139279407 16:65757230-65757252 CTTTGGTGAGCAGAAGCTTCTGG + Intergenic
1142079152 16:88139205-88139227 CCTTGGGGCTCTGAGCCTCCTGG - Intergenic
1142267868 16:89072810-89072832 CCTGCGCGCTCAGAAGCCTCAGG - Intergenic
1142742026 17:1936924-1936946 CCTCGGCCCTCAGCAGCTTCAGG + Exonic
1144658492 17:17053080-17053102 ACTTGAGGCTCAGGAGCCTCAGG + Intronic
1144939777 17:18930572-18930594 TCTTGGGGCACTGGAGCTTCTGG - Exonic
1145064478 17:19752866-19752888 CCTTGGGTCAGAGAAGCTGCAGG + Intergenic
1145790811 17:27625509-27625531 CTTTGGGGCCCAGTGGCTTCTGG - Exonic
1146054878 17:29576025-29576047 CCCTGGGGCTCAGAACCTACTGG + Intronic
1146122964 17:30211084-30211106 CCTTGGGCCTCATAAGCGCCTGG + Intronic
1147339375 17:39744731-39744753 AATTGGGGCTCAGAAGCCCCGGG - Intronic
1148146530 17:45368607-45368629 CTTTTGGGCTCAGAAGCTCAAGG + Intergenic
1150076758 17:62198746-62198768 CCTTAGGGCTCTGAGGCCTCAGG + Intergenic
1151111217 17:71680302-71680324 CCTTAGGGGTCAGAATCTGCAGG - Intergenic
1151484050 17:74387530-74387552 CCCTGGGGCTCAAAAGAATCTGG - Intergenic
1151572276 17:74932812-74932834 GCTAGGAGCTCAGAAGATTCAGG - Intronic
1152404061 17:80086629-80086651 CCTTGGGCCTCAGAAGGGTTGGG - Intronic
1152570855 17:81120682-81120704 CCTTGGGGCTCCGGAGGCTCTGG + Exonic
1152916572 17:83039804-83039826 CCCTGGGGCTCAGAAGACGCAGG - Intronic
1154441330 18:14392631-14392653 TCATGGGGCTCAGAGGCTCCAGG + Intergenic
1157991024 18:52496577-52496599 CTTTGGGTCTCAGTAGCTCCTGG + Intronic
1158432402 18:57401168-57401190 ACTTGGGGCTCAGGACCCTCTGG + Intergenic
1158729281 18:60004344-60004366 ACTTGGGGCTCAGGACCCTCTGG - Intergenic
1160164886 18:76501815-76501837 CCTTGGGGCCAGGAAGCTTGGGG - Intergenic
1160165068 18:76503903-76503925 CCTTGGTGTGCAGAAACTTCTGG + Intergenic
1161531612 19:4793123-4793145 TCATGGGGCTCAGAGGCTCCAGG - Exonic
1163008277 19:14409699-14409721 TCCTGGGGCTCAGGACCTTCGGG - Intronic
1165431188 19:35774326-35774348 CATTGGAGCTCAAAAGCTACTGG - Intergenic
1165475300 19:36026834-36026856 ACTTTGGGATCCGAAGCTTCGGG + Intronic
1165631469 19:37305295-37305317 CCTTGAGGCACTGAATCTTCTGG - Intergenic
1167506130 19:49871995-49872017 AAATGGGTCTCAGAAGCTTCAGG - Intronic
1168686586 19:58352828-58352850 GCTTGGGGCTCAGAGACATCGGG + Intronic
926019690 2:9484181-9484203 CCTGGCGCCTCAGAAGATTCCGG + Intronic
929278171 2:40048050-40048072 CCTTGAGGCTCTGAGGCTTCAGG + Intergenic
931976171 2:67646568-67646590 CCTTGGGGCTCTGCAGTTGCTGG - Intergenic
932593379 2:73080128-73080150 CCCTGGGCCTCAGGAGCCTCAGG + Intronic
933455001 2:82508670-82508692 CTTTGGGGCTCTGCAGTTTCTGG + Intergenic
934121492 2:88844584-88844606 CCTTGTGGCTCAGTTTCTTCAGG + Intergenic
936518585 2:113197988-113198010 CCCTGGGGCCCACAAGCCTCAGG - Intronic
937050223 2:118882486-118882508 GCTTGGGTCTCAGAAGCTGAGGG - Intergenic
937074483 2:119091027-119091049 CCTTGGGTCTCCGTCGCTTCTGG - Intergenic
937966357 2:127514572-127514594 CCTTGGGGCTCTGCAGTTCCTGG + Intronic
938444610 2:131367246-131367268 CCCTGGGGCTCCCAGGCTTCGGG - Intergenic
940129955 2:150369912-150369934 CCTTGGGGCTCTGCAGTTCCTGG + Intergenic
942201370 2:173574662-173574684 CATTGGGGCTCAGAATATTAAGG + Intergenic
942315472 2:174693130-174693152 CTTTGGGGCTCAGCAGGTCCTGG + Intergenic
942913610 2:181276060-181276082 ACTTGGGAATCAGAAGCTGCAGG - Intergenic
943426619 2:187745746-187745768 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
947864617 2:233387773-233387795 CTCTGGGGCTCAGAAGCTCCAGG - Intronic
948597971 2:239092572-239092594 CCCTGGGGTTCAGAAGCTTCTGG + Intronic
1170307099 20:14950622-14950644 GCTTGGTGCACAGAAACTTCAGG + Intronic
1171422296 20:25025303-25025325 TCATGGTGCTCAGAAGCTCCTGG - Intronic
1173192063 20:40884336-40884358 CTTTGGGGCTCACATGCTCCAGG - Intergenic
1175550384 20:59813706-59813728 CCTGGGGGCTGAGAAGGTTCAGG + Intronic
1176832899 21:13763591-13763613 TCATGGGGCTCAGAGGCTCCAGG - Intergenic
1177035828 21:16041319-16041341 CCTTGGAACTCATAAGCTTGTGG + Intergenic
1178842164 21:36146453-36146475 CCTTGTGGCTCAGTGGCATCTGG - Exonic
1179500280 21:41804495-41804517 CCCAGGGGCTCAGAAACTTTGGG - Intronic
1180046737 21:45309874-45309896 CCTTGGGGATGAGAAGCGGCTGG - Intergenic
1181001364 22:19989229-19989251 CCCTGGTGCTCAGAGGCCTCTGG - Intronic
1181094795 22:20497601-20497623 CCTTCAGGCTCAGAAAATTCTGG - Intronic
1181168202 22:20994368-20994390 CCCTGAGGCTCAGAGGCTGCAGG + Intronic
1181628964 22:24140472-24140494 TCTGGGTGCCCAGAAGCTTCTGG + Intronic
1183597117 22:38819343-38819365 CCAGGGGGCTCAGCTGCTTCAGG - Exonic
1184419757 22:44372871-44372893 CCTGAAGGCCCAGAAGCTTCTGG - Intergenic
1184675545 22:46040759-46040781 ACTTGGGGCCCAGAAGCTTCAGG - Intergenic
1185134721 22:49063116-49063138 GCAGGGGGCTCAGAAGCCTCAGG + Intergenic
1185395852 22:50587591-50587613 CCTAAGGGCTCAGATGCCTCAGG + Intronic
949750301 3:7344754-7344776 ACTTGAGGCTCAGAAGGTTAGGG + Intronic
950364721 3:12474889-12474911 CCTGGGGGCTGAGAGGCTGCAGG - Intergenic
950427377 3:12931761-12931783 CCCTGGGGCCCAGCAGCCTCGGG - Intronic
954199408 3:49015246-49015268 CCTTGGGGGTCAGGGGCTTGAGG + Exonic
954673853 3:52304974-52304996 GCTTGGTGCTCAGGACCTTCTGG - Intergenic
954796770 3:53165447-53165469 CCTTGGAGCTCAGAGGCCTGGGG + Intronic
955751758 3:62190532-62190554 CCTTGGGGCTGAGAGGTTTAAGG - Intronic
958141681 3:89570800-89570822 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
959527042 3:107388926-107388948 CCTTGGGGCTCACAGGCCTTGGG - Intergenic
959637259 3:108589469-108589491 CCCTCGCTCTCAGAAGCTTCCGG + Intronic
963196790 3:142541081-142541103 CCTTAGGGCTCATCTGCTTCTGG - Intronic
968009816 3:195266788-195266810 CCTGTGGGCTCAGAATCTCCTGG - Intronic
968943141 4:3649674-3649696 GCTGAGGGCTCAGAAGCTCCTGG + Intergenic
969566599 4:7982296-7982318 CCTTGGGGCTCAGATGGTGCTGG + Intronic
969671169 4:8591165-8591187 CCTTGGGGCTCATGAGGTTGGGG - Intronic
969888613 4:10239070-10239092 CCTTGGTGCTCAGAGCCTCCTGG + Intergenic
970533878 4:17009665-17009687 CCTTTGGTCTTAGAGGCTTCTGG + Intergenic
974386127 4:61202697-61202719 CGTCGGAGCTCAGAAGCTTAGGG + Intronic
974686732 4:65241539-65241561 CTTTGGGGCTCCGCAGTTTCTGG - Intergenic
979885030 4:126016506-126016528 GCTTGGGTCTCTGATGCTTCTGG - Intergenic
979946891 4:126843574-126843596 CCTTGGGGCTCTGAGGTTACTGG + Intergenic
980108812 4:128614993-128615015 GCTTGGGGCTCAGAAGCCTGTGG - Intergenic
980169097 4:129265458-129265480 CCTTATTGCTCAGAAGCTACTGG - Intergenic
980308643 4:131099362-131099384 CTTTGGGGCTCTGCAGCTCCTGG - Intergenic
985767326 5:1786932-1786954 CCTTGGGACTCACAGGCCTCAGG - Intergenic
985780174 5:1866355-1866377 CCTTGGAACTCAGCAGTTTCCGG + Intergenic
986431998 5:7690753-7690775 CCTTGGGGCCCTGCAGCCTCTGG - Exonic
987437428 5:17912854-17912876 GCATTGGGGTCAGAAGCTTCGGG + Intergenic
988599689 5:32628158-32628180 GCTTGTAGGTCAGAAGCTTCAGG + Intergenic
990980822 5:61601201-61601223 CCATGGGACTCAGGAGCTGCTGG + Intergenic
990981427 5:61605650-61605672 CCTGGGGTCTCAGCACCTTCTGG - Intergenic
993116498 5:83725562-83725584 CATTTGGCCTCAGTAGCTTCTGG - Intergenic
999707760 5:154289547-154289569 CCTTGGGGCTGACAAGCTGTAGG + Intronic
1000291405 5:159874750-159874772 CCTTGGGGGTCAGAGTCCTCAGG + Intergenic
1002108532 5:176892492-176892514 CCCTGGGGCTCTTAAGCTACTGG - Intronic
1002198344 5:177513173-177513195 CCTTGGCGGCCAGAGGCTTCTGG - Intronic
1002457438 5:179353608-179353630 CCTGGGGTCTCAGAAGCCTCTGG - Intergenic
1002886192 6:1296491-1296513 AACTGGGGCTCAGAAGATTCAGG - Intergenic
1003171717 6:3725835-3725857 CCATGGGGCTCGGGAGCATCTGG - Intronic
1008572240 6:52827158-52827180 CCTTGGGGCTCAACAACTTAAGG + Intergenic
1011495519 6:87933551-87933573 CTGTGGGGCTCAGAAGATTCAGG - Intergenic
1011498950 6:87966788-87966810 CAATGGGGCTCAGAAACCTCAGG - Intergenic
1013681041 6:112526600-112526622 CCATGGGGCACCGAAGCTTTAGG + Intergenic
1014605551 6:123469633-123469655 CCTTGGGGTTGAGAAGCCCCTGG - Intronic
1016076667 6:139804546-139804568 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1016816322 6:148306381-148306403 CCTTGGGGCTCAGAGGCCTGTGG - Intronic
1017749662 6:157479598-157479620 CCTGTGAGCTCAGAAGCTTTTGG - Intronic
1019301039 7:303680-303702 TCCTGGGCCTCAGCAGCTTCTGG - Intergenic
1019301060 7:303772-303794 TCCTGGGCCTCAGCAGCTTCTGG - Intergenic
1019301079 7:303865-303887 TCCTGGGCCTCAGCAGCTTCTGG - Intergenic
1019301101 7:303958-303980 TCCTGGGCCTCAGCAGCTTCTGG - Intergenic
1019819162 7:3227956-3227978 CTATGGGGAGCAGAAGCTTCTGG - Intergenic
1020089815 7:5332834-5332856 CCTTGGGGCCCCGCAGCTTCCGG + Exonic
1020582217 7:10017566-10017588 CCGAGGGACTCAGATGCTTCTGG + Intergenic
1022440188 7:30426751-30426773 CCCTGGGGCACAGCAGCTTCTGG + Intronic
1022511687 7:30938781-30938803 CCTTGGGGATCAGCAGTTTCTGG - Intronic
1022947377 7:35300835-35300857 CCTGTGGTCTCAGAAACTTCAGG + Intergenic
1024746201 7:52409123-52409145 CCTGGGGGCTCACAGGCTACAGG + Intergenic
1031067168 7:117117473-117117495 ACTTGGGGCACAGAATTTTCTGG + Intronic
1031975865 7:128093199-128093221 CCCTGGAGCTCAGAATCCTCAGG + Intergenic
1034942188 7:155237719-155237741 CCTTGGGCCTCAGTAGCTCATGG - Intergenic
1034980270 7:155471411-155471433 CCTTGGGGCTCTGAATCCACAGG - Intergenic
1035266004 7:157690617-157690639 CCTCGGGGCGCAGCAGCTGCGGG + Intronic
1037892507 8:22630729-22630751 CCATGGGGATCAGCAGCTTGTGG - Intronic
1041054103 8:53964931-53964953 CCTTTGAGCTCAGAAGATTGAGG - Intergenic
1043662220 8:82758190-82758212 CCTTGGGGCTCTGCAGTTGCTGG - Intergenic
1043707969 8:83377620-83377642 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG + Intergenic
1048385509 8:133909020-133909042 TCTTGTCACTCAGAAGCTTCTGG - Intergenic
1049307241 8:141910604-141910626 CCTTGTGCCTCAGGAGCTGCTGG - Intergenic
1049372282 8:142273615-142273637 CCATGAGACTCAGAAGGTTCAGG - Intronic
1049622811 8:143606197-143606219 CCTGGGGGCTCAGGACCTTCAGG + Intronic
1049820811 8:144632081-144632103 CTTTGGAGGTCAGAAGCTCCAGG - Intergenic
1051437657 9:17050087-17050109 CCATGGGCCTCAGAGGCTACAGG - Intergenic
1057647316 9:96888967-96888989 TCTTGAGGATCAGAAGCTCCTGG - Intergenic
1058487587 9:105457978-105458000 CCTTGGGGCTCTGCAGTTACTGG - Intronic
1059852968 9:118364192-118364214 CTTTGGGGCTCTGCAGCTCCTGG + Intergenic
1060799186 9:126532906-126532928 ACTGGGGCCTCGGAAGCTTCTGG - Intergenic
1060866831 9:127007092-127007114 TCCTGGGTCTCAGAAGCCTCTGG - Intronic
1061095190 9:128452610-128452632 CGTTGGAGCTCAGGAGCTTGAGG + Intergenic
1061798586 9:133102419-133102441 CCTTGGGGCTCAGAAGCTTCAGG - Intronic
1062140726 9:134957338-134957360 CCTCGGGGCACAGAACCCTCTGG + Intergenic
1062408159 9:136407681-136407703 GCTCTGGGCTCAGAAGCTGCTGG - Intronic
1062619304 9:137412203-137412225 CCTTTGGGATCAACAGCTTCTGG - Intronic
1062674398 9:137731985-137732007 CCTTGGGGCTCTGCAGTTGCTGG - Intronic
1186671451 X:11771092-11771114 CCTTGGTGCTTATTAGCTTCTGG + Intronic
1187319397 X:18226518-18226540 ACTCGGGGTTCAGAAGCTGCAGG + Intergenic
1189311978 X:40025656-40025678 CCCTGGGGCTCAGACTGTTCTGG - Intergenic
1190039055 X:47054367-47054389 CCTGCGGGCACAGAAGCTTCGGG + Exonic
1192225022 X:69222016-69222038 TCTTGGAGCTGAGAAGCTCCAGG - Intergenic
1192759807 X:74085587-74085609 GCTTGGGGCTCAGAAGCCTTTGG - Intergenic
1202339151 Y:23842466-23842488 CCAGTGGGCTCAGAAGTTTCTGG - Intergenic
1202531615 Y:25827606-25827628 CCAGTGGGCTCAGAAGTTTCTGG + Intergenic