ID: 1061799011

View in Genome Browser
Species Human (GRCh38)
Location 9:133104124-133104146
Sequence GATCCAGGTGTGGCTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061799005_1061799011 15 Left 1061799005 9:133104086-133104108 CCTTTCGTGGCTGCAGCTGGTCT 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG 0: 1
1: 0
2: 0
3: 25
4: 259
1061799003_1061799011 20 Left 1061799003 9:133104081-133104103 CCTGTCCTTTCGTGGCTGCAGCT 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG 0: 1
1: 0
2: 0
3: 25
4: 259
1061799007_1061799011 -9 Left 1061799007 9:133104110-133104132 CCCAGATACCAGCTGATCCAGGT 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG 0: 1
1: 0
2: 0
3: 25
4: 259
1061799008_1061799011 -10 Left 1061799008 9:133104111-133104133 CCAGATACCAGCTGATCCAGGTG 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG 0: 1
1: 0
2: 0
3: 25
4: 259
1061799002_1061799011 25 Left 1061799002 9:133104076-133104098 CCAGGCCTGTCCTTTCGTGGCTG 0: 1
1: 0
2: 5
3: 18
4: 215
Right 1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG 0: 1
1: 0
2: 0
3: 25
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061799011 Original CRISPR GATCCAGGTGTGGCTCTGCT AGG Intronic
901313093 1:8284769-8284791 GAGACAGGTGTGGCTCTCCCTGG - Intergenic
902107967 1:14053391-14053413 AGTCCAGGTGTGGCTTAGCTGGG - Intergenic
902213269 1:14918891-14918913 AATCCAGGTGTGGCTTAGCTGGG - Intronic
902687844 1:18090575-18090597 AATCCAGGTGTGGCTTAGCTGGG + Intergenic
903027345 1:20438763-20438785 AATCCAGGTGTGGCTTAACTGGG - Intergenic
903218078 1:21854165-21854187 GAGCCAGGTGTGGCTGGGCCGGG - Intronic
903362836 1:22787789-22787811 AATCCAGGTGTGGTTTAGCTGGG + Intronic
903645909 1:24896443-24896465 GAACCAGGTGTCGCTGAGCTGGG - Intergenic
904331710 1:29762257-29762279 GGCCCAGGTGTTGCTGTGCTTGG + Intergenic
904956408 1:34287687-34287709 AATCCAGGTGTGGCTTAGCTGGG - Intergenic
908551985 1:65217605-65217627 ACTCCAGGTTTGGCTCTGGTGGG - Intronic
908888386 1:68816079-68816101 TATCCATGTGTGACTCTACTGGG + Intergenic
909145082 1:71919957-71919979 GCTCCAGCTGTGGCTCTCCAGGG + Intronic
909572562 1:77133611-77133633 GGTCCATGTGTTCCTCTGCTGGG + Intronic
912568869 1:110607418-110607440 GAGCCAGGTGCGGCGCTGCGTGG - Exonic
914835594 1:151204110-151204132 GTTACAGGTAGGGCTCTGCTGGG - Intronic
915648751 1:157292590-157292612 GGTCCAGGTGTCGTTCAGCTGGG - Intergenic
915661941 1:157411935-157411957 AATCCAGGTGTGGTTCAGCTGGG + Intergenic
915765310 1:158356110-158356132 GAAACAGCTGAGGCTCTGCTGGG + Intronic
917000749 1:170355678-170355700 GACCCAGGTGTTGCTCTTCTAGG + Intergenic
922128612 1:222754655-222754677 AATCCAGGAGTGGCTTAGCTGGG - Intergenic
923338958 1:232991802-232991824 GATCCAGGTGTGGGCAGGCTTGG - Intronic
923744240 1:236686237-236686259 GTGGCAGGCGTGGCTCTGCTCGG + Intergenic
924071891 1:240288982-240289004 AATCCAGGTGCAGCTCAGCTAGG - Intronic
1063010280 10:2014863-2014885 TATTCAGGTGAGGTTCTGCTCGG + Intergenic
1065559025 10:26944083-26944105 TATCCTGAGGTGGCTCTGCTTGG + Intergenic
1067432039 10:46251329-46251351 GATGCAGGTGTGGCTCCATTTGG - Intergenic
1070057053 10:72945523-72945545 GATCCTGGAGTGGCTTTGCTGGG - Intronic
1070726464 10:78794871-78794893 GAGCCAGGTGCAGCTCTGTTGGG - Intergenic
1070818878 10:79343196-79343218 GATCCAGGACTGGCTGTGCATGG + Intergenic
1071305242 10:84293788-84293810 GAACCAGCTGGGGCTCTGCAGGG - Intergenic
1072912189 10:99512845-99512867 AACCCAGGAGTAGCTCTGCTTGG + Intergenic
1073084981 10:100882589-100882611 TCTCCAGCTATGGCTCTGCTGGG + Intergenic
1075004589 10:118820760-118820782 GATTCAGATGTGGCTGGGCTAGG - Intergenic
1075667968 10:124244377-124244399 GATTCAGGTCCGGCTCTGCCCGG + Intergenic
1076598680 10:131643003-131643025 GACCCAGGTTGGGCCCTGCTGGG + Intergenic
1076709483 10:132324063-132324085 GGTCCAGGTGTGGGTGTGTTGGG - Intronic
1076778025 10:132709081-132709103 GACCCAGGAGTGGCTTTTCTGGG + Intronic
1077505289 11:2927313-2927335 CATCCAGGTGAGGCTCTGGTGGG + Intergenic
1077595171 11:3525741-3525763 AATCCAGGCGTGACTCAGCTGGG - Intergenic
1077974434 11:7232834-7232856 AATCCAAGTGTGGCTTAGCTGGG - Intergenic
1079375197 11:19886317-19886339 GACCCAGGTCAGGCTCTGCCTGG + Intronic
1080241296 11:30129811-30129833 GATCCAAGTGTGACTCTCCCAGG - Intergenic
1080877674 11:36291286-36291308 AATCCAGGCGTGGCTTCGCTGGG - Intergenic
1084251073 11:67899720-67899742 AATCCAGGCGTGACTCAGCTGGG - Intergenic
1084744018 11:71156110-71156132 GATCAAGGTGTGGCAGGGCTGGG - Intronic
1084821765 11:71696327-71696349 AATCCAGGCGTGACTCAGCTGGG + Intergenic
1085514404 11:77103935-77103957 GGCCCAGCTGTGGCTCTTCTGGG + Intronic
1085978741 11:81694645-81694667 GATCCAGGTGGGTCTATTCTTGG - Intergenic
1087482513 11:98719126-98719148 GATCCAGGGATGTTTCTGCTAGG + Intergenic
1088112091 11:106273836-106273858 TATCCAGTAGTGGCACTGCTGGG + Intergenic
1088905984 11:114155891-114155913 GATACAGGTGTAGCCCTCCTGGG + Intronic
1089630006 11:119778619-119778641 GATTCAGGTGTGAATCTGCCCGG - Intergenic
1090043771 11:123313389-123313411 GAGCCAGGTGCGGCTCTGTAGGG - Intergenic
1090237488 11:125160158-125160180 GATCCAGGTGGGGCTGTGGTGGG - Intergenic
1092421337 12:8334514-8334536 AATCCAGGCGTGACTCAGCTGGG - Intergenic
1094201879 12:27803444-27803466 GATTTGGGTGTCGCTCTGCTAGG - Intergenic
1096593733 12:52680280-52680302 GCTTCAGCTCTGGCTCTGCTGGG - Exonic
1096685415 12:53285344-53285366 GATTCAGGTGTGGGCCTGCTGGG + Intronic
1098569511 12:71972994-71973016 GATCCAGGAGCTGCTGTGCTGGG + Intronic
1101986454 12:109451097-109451119 GAACCAGGAGTGGACCTGCTGGG + Exonic
1102436505 12:112928500-112928522 GATCCAGGCTGGGCTCAGCTGGG + Intronic
1106052180 13:26201895-26201917 GTCCCAGCTGTGGATCTGCTTGG + Intronic
1106823099 13:33488307-33488329 CATCCAGGTGTGCTTCTCCTCGG + Intergenic
1107287744 13:38814854-38814876 GATCCATGGGGGGCTCTACTAGG + Intronic
1107834995 13:44405844-44405866 GATCCAGCCTTGGCCCTGCTAGG - Intergenic
1111247282 13:85556029-85556051 AATCCAGCTGTGGCTAAGCTGGG - Intergenic
1111264087 13:85784349-85784371 GATCCAAGGTTGGCTCTACTAGG + Intergenic
1111980431 13:95010059-95010081 GATCCAGGTTTGGCTTTTTTGGG + Intergenic
1112905269 13:104410662-104410684 AATCCAGATGGGGTTCTGCTGGG + Intergenic
1113045061 13:106146659-106146681 AAACCAGGTGTGGCCCTTCTGGG + Intergenic
1114208474 14:20595844-20595866 GATCTGGGTGTGAATCTGCTGGG + Intronic
1115735602 14:36325235-36325257 AATTCAGGAGTGGCTTTGCTTGG + Intergenic
1116351933 14:43873384-43873406 TATCCATGTGTGGCTCTGGAAGG - Intergenic
1117396124 14:55312305-55312327 GCTCCACCTGTGGCTCTGCAGGG + Intronic
1117412973 14:55467686-55467708 GAGCCAGGTGTGGCGCAGCGAGG + Intergenic
1117532689 14:56674862-56674884 GATCCAGGTTAGGCACAGCTGGG + Intronic
1119134360 14:72203446-72203468 GATCTGGGTTTGGCTTTGCTGGG + Intronic
1119980569 14:79076344-79076366 AATCCAGATGTGGCTTAGCTGGG + Intronic
1120029625 14:79626266-79626288 GATCTAGCTCTGGCTCTTCTTGG - Intronic
1120135679 14:80865934-80865956 GAGACAGGTGTGGCTTTGCTGGG - Intronic
1122897619 14:104768360-104768382 GCTCCAGATGTGGCTGTTCTTGG + Intronic
1128233601 15:66052224-66052246 TCTCCAGGTGGGGCTGTGCTGGG + Intronic
1128266640 15:66272798-66272820 TAACCAGGTGTGGCACTACTTGG + Intergenic
1128686307 15:69688499-69688521 AATCCAGGAGTGGCTTGGCTGGG - Intergenic
1129245206 15:74274995-74275017 CCTCCAGGTATGGCTCTGCCCGG - Intronic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1129677368 15:77639209-77639231 AATCCAGGTGAGGCTTAGCTGGG - Intronic
1130958128 15:88641442-88641464 GATCCAGGTGTCGCCCAGGTTGG + Intronic
1131741773 15:95400597-95400619 GATGTAGGTGGGGCTCAGCTGGG + Intergenic
1131878210 15:96833880-96833902 GATGCAGGGGTGGGTCTGGTGGG - Intergenic
1132939392 16:2499437-2499459 GAGCCAGGGCTGGCTCTGATGGG + Intronic
1132939398 16:2499459-2499481 GCTCCAGGGCTGGCTCTGATGGG + Intronic
1132939404 16:2499481-2499503 GCTCCAGGGCTGGCTCTGATGGG + Intronic
1133136128 16:3713349-3713371 GGTCCAGGTGAGGCTCTTTTTGG + Intronic
1133233759 16:4378409-4378431 GACCCTGGTCTGGCCCTGCTGGG + Intronic
1135253264 16:20919047-20919069 AATCAAGACGTGGCTCTGCTAGG - Intronic
1135379749 16:21985634-21985656 GATCTAGTTTTGGTTCTGCTGGG - Intronic
1135937288 16:26792105-26792127 GTTCCTGGTTTGGCTTTGCTGGG - Intergenic
1138490378 16:57372916-57372938 GAGCCAGGTGTGGGTGTGCCAGG + Intronic
1139561619 16:67746189-67746211 GAGCCAGGTGTGGCTGGGCATGG + Intronic
1141500734 16:84442606-84442628 GGTCCTGGGGTGGCTCTGCGGGG + Intronic
1141808183 16:86356026-86356048 AATCCAGGTTGGGCTCAGCTGGG + Intergenic
1142371896 16:89687074-89687096 GATCCAGCTCGGGCGCTGCTGGG + Intronic
1144509557 17:15864221-15864243 GTTCCATGTGTGCCTGTGCTTGG + Intergenic
1145058341 17:19717240-19717262 GAGCCAGGGGTGGCAGTGCTTGG + Intronic
1145173667 17:20681861-20681883 GTTCCATGTGTGCCTGTGCTTGG + Intergenic
1147027226 17:37597314-37597336 AATCTAGGAGTAGCTCTGCTGGG - Intronic
1147350009 17:39835073-39835095 GATCCAGCTTTGGCTCTGGCGGG - Intronic
1147606370 17:41775967-41775989 GAGCCTGGTGTAGCTCTGGTGGG - Intronic
1148456536 17:47814331-47814353 GTTCCAGGAGCAGCTCTGCTGGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149579758 17:57741434-57741456 GATCCAGGTGAGGCTGTGGGTGG - Intergenic
1150419498 17:65019291-65019313 GATCCAGCAATGGCACTGCTAGG + Intronic
1150968016 17:69994064-69994086 GATCTAGGTGTGGCTTAGCTGGG + Intergenic
1151463494 17:74269747-74269769 CATGCAGGTGTGGCTTTTCTTGG - Intergenic
1153133659 18:1887555-1887577 GATCCCAGTGTGGCTCTGGCAGG + Intergenic
1154388035 18:13913221-13913243 GGTCCAGGTGAGGCTGTGCAGGG - Intronic
1160070173 18:75621507-75621529 GATCAAGCTCTGACTCTGCTCGG - Intergenic
1161101052 19:2422106-2422128 GCCCCAGGGGTGGGTCTGCTGGG - Exonic
1161405835 19:4090694-4090716 GATGAAGGTGTGGTTCTGCAAGG + Exonic
1163586937 19:18169311-18169333 GGCCCAGGGGCGGCTCTGCTTGG - Exonic
1164586791 19:29480746-29480768 GCTCCTGGCCTGGCTCTGCTTGG - Intergenic
1165609100 19:37134611-37134633 GATACAGGTGAGGCTGTGTTAGG - Intronic
1165759216 19:38310752-38310774 GCACCAGCTGTGCCTCTGCTTGG + Intronic
1166756617 19:45196403-45196425 GGTCCAGGTGAGGCTGAGCTAGG + Intronic
1168136548 19:54355858-54355880 AATTCAGGAGTGGCTCAGCTGGG - Intronic
925305076 2:2842539-2842561 GTCCCAGGTGTGGCTCTGGTGGG + Intergenic
927137187 2:20105540-20105562 GATCCAGGGCTGGCTTTGCCCGG + Intergenic
927479110 2:23436549-23436571 GTCACAGGTGTGGATCTGCTGGG + Intronic
927846558 2:26475309-26475331 GGGCCAGGTGTGGTGCTGCTGGG + Intronic
928742199 2:34368509-34368531 GAGCTAGGTCTGGCTCTGCAAGG + Intergenic
931969100 2:67566431-67566453 AATCTGGGTGTGGCTCAGCTGGG + Intergenic
932092263 2:68816787-68816809 GACCCAGATCTGGCTCGGCTGGG + Intronic
933812065 2:86038997-86039019 TATACTGGTGTGGATCTGCTGGG + Intronic
933813415 2:86047637-86047659 GACCCAGGCCAGGCTCTGCTGGG - Intronic
934150747 2:89145411-89145433 GCACCAAGTGTGGCGCTGCTGGG - Intergenic
934216530 2:90036618-90036640 GCACCAAGTGTGGCGCTGCTGGG + Intergenic
935216973 2:100982335-100982357 GATCCAGGAGCAGCTCTGCCTGG + Exonic
935577895 2:104729712-104729734 GATACAGTTGTGGCAGTGCTAGG + Intergenic
937068625 2:119042917-119042939 TATCCAGGAGTGGCATTGCTAGG + Intergenic
937470770 2:122172226-122172248 GATGTACTTGTGGCTCTGCTGGG - Intergenic
938632126 2:133178351-133178373 TATCCAGGTGTGGTTGTGGTGGG + Intronic
940055596 2:149509662-149509684 AATCCAGGTGTGGTTTGGCTGGG + Intergenic
945819836 2:214650578-214650600 AATCCAGGAATGGCTTTGCTGGG - Intergenic
946234589 2:218315954-218315976 GATCTAGCTTGGGCTCTGCTGGG + Intronic
948244098 2:236463790-236463812 GAACCAGATGTGGCTCAGCTGGG + Intronic
948632444 2:239310723-239310745 GACCCAGTTTTGGGTCTGCTTGG - Intronic
1170827199 20:19806952-19806974 GATCTAGGTTGGGCTCAGCTAGG + Intergenic
1171023474 20:21608037-21608059 GATCTTAGAGTGGCTCTGCTGGG - Intergenic
1171370993 20:24661754-24661776 GATCCAGGTCTTGCTCTAGTTGG - Intronic
1172751189 20:37252432-37252454 GGTCCCAGTGTGGCTCTGCTGGG - Intronic
1172813692 20:37669967-37669989 GATCCAGAAGTGTCTTTGCTAGG - Intergenic
1174011508 20:47453514-47453536 AATCCAGGAGTGGCTTTGCTGGG + Intergenic
1174122299 20:48275310-48275332 GATCCAGGCTGGGCTCTGCTGGG + Intergenic
1174262947 20:49310561-49310583 GATCCAGGTGTGGCTTAGTTAGG + Intergenic
1176630605 21:9133418-9133440 GATCCAGGTTTTTCTTTGCTAGG - Intergenic
1180204633 21:46250754-46250776 AATCCAGGTGTAGCTTAGCTTGG - Intronic
1181677539 22:24466061-24466083 AATCCAGGTGTAGCTCAGCCAGG - Intergenic
1183232204 22:36590078-36590100 GATGCAGCTGGGGCCCTGCTGGG - Intronic
1183311782 22:37113731-37113753 GATCCAGGTGTCGGCCGGCTTGG - Intergenic
1183951466 22:41355285-41355307 GTTCCAGGCCTGGCTCTCCTGGG + Intronic
1184192939 22:42907133-42907155 GAGCCTGGGGTGGCTCAGCTTGG + Intronic
1184204753 22:42994816-42994838 GCTCTAGGTGTGGATATGCTAGG - Intronic
1184835969 22:47021261-47021283 GCTACAGGTGGGGTTCTGCTAGG - Intronic
1184835980 22:47021304-47021326 GCTACAGGTGGGGTTCTGCTAGG - Intronic
1184835991 22:47021347-47021369 GATACAGGTGGAGTTCTGCTAGG - Intronic
951168078 3:19506607-19506629 GATCTCGGTTTGGCTCTCCTGGG + Intronic
954303571 3:49713976-49713998 GATCCTGGTGCGGCTCTGGAGGG + Exonic
955772911 3:62404601-62404623 GAGCCAATTGTGGCTCTCCTTGG + Intronic
960121439 3:113951475-113951497 GCTCCAGGTGTGGCTCCACTGGG - Intronic
961042039 3:123684372-123684394 TATCAAGGGGAGGCTCTGCTAGG - Intronic
961756463 3:129130058-129130080 GACCCAGCTGGGGCTCTCCTTGG - Exonic
961899019 3:130193724-130193746 AATCCAGGCGTGACTCAGCTGGG - Intergenic
962087283 3:132205012-132205034 GATCTAGGCTGGGCTCTGCTGGG + Intronic
962844790 3:139264643-139264665 CGTCCAGGTGAGGGTCTGCTGGG + Intronic
963579058 3:147100968-147100990 GATTCAGGAGTGACTCTGATTGG + Intergenic
964330224 3:155594015-155594037 GATCCAGGTGCGGGCCTCCTCGG + Exonic
964570251 3:158102900-158102922 GATGCACGTGTGGCCCCGCTGGG - Intronic
967943113 3:194781397-194781419 AATTCAGGTGTGGCTTAGCTGGG + Intergenic
967979893 3:195059437-195059459 GACCCTCCTGTGGCTCTGCTGGG - Intergenic
968088364 3:195884908-195884930 GAGGCAGGTGAGGCTCTGCAGGG + Exonic
968292751 3:197551586-197551608 GATCCAGCAGTGCCACTGCTGGG - Intronic
968764138 4:2459338-2459360 GACCCACCTGTGGCTCTGGTGGG - Intronic
968816175 4:2823091-2823113 GGCCCAGCTGGGGCTCTGCTGGG - Intronic
969009874 4:4053172-4053194 AATCCAGGCGTGACTCAGCTGGG - Intergenic
969262162 4:6040903-6040925 GATCCAGGTGTGGCTGTCAAGGG - Intronic
969744357 4:9058086-9058108 AATCCAGGCGTGACTCAGCTGGG + Intergenic
969803762 4:9590197-9590219 AATCCAGGAGTGACTCAGCTGGG + Intergenic
971402416 4:26288212-26288234 AATCCAGGAGTGGCTTAGCTGGG + Intronic
974664084 4:64935646-64935668 GCCCCAGGTGGGGCTCTGATGGG - Intergenic
975498003 4:75055514-75055536 GTTCCAGTTGTGGCATTGCTGGG - Intergenic
977113279 4:92988144-92988166 AATCCAGGAATGGCTCAGCTGGG + Intronic
978813766 4:112879520-112879542 GATTCAGGAGTGGCTTGGCTGGG - Intronic
979407556 4:120331808-120331830 GACCCAGGTGTGGCTTAGCCAGG - Intergenic
980297191 4:130936480-130936502 GATCCAGGTATTCCACTGCTGGG - Intergenic
982304148 4:153911871-153911893 GAGCCAGGAATGGCTGTGCTGGG - Intergenic
983601140 4:169530023-169530045 TACCCAGGAGTGGGTCTGCTGGG - Intronic
984714232 4:182911722-182911744 TATCCAGTTGTGGATATGCTTGG - Intronic
984878711 4:184391682-184391704 AATCCAGGCGTGGCTTAGCTGGG - Intronic
985259013 4:188097699-188097721 CAGGCAGGTGTGGCTCTGCCTGG - Intronic
985709711 5:1421525-1421547 GGTCCACGTGTGGCTGTGTTTGG - Intronic
985822082 5:2167204-2167226 GAACCAGCTGGGGCTCTCCTTGG - Intergenic
985938123 5:3112084-3112106 GATCCAGCTCTGGAACTGCTTGG + Intergenic
986769161 5:10956175-10956197 GACTCAGCTGTGTCTCTGCTGGG - Intergenic
988915292 5:35887439-35887461 GATCTAGATTGGGCTCTGCTGGG + Intergenic
995555416 5:113323232-113323254 AATCCAGGAGTGGCTTGGCTGGG - Intronic
996318070 5:122183566-122183588 CATCGAGGTGGGGCTCTCCTGGG + Intergenic
996466637 5:123810314-123810336 GACCCCGGTGTCACTCTGCTTGG + Intergenic
997429436 5:133827261-133827283 CAGCCAGGTGTGTCTGTGCTGGG - Intergenic
998286183 5:140863055-140863077 GTTCCACGTGGGGCTCTGCACGG + Intronic
999514142 5:152284099-152284121 AATCCAGAAGTAGCTCTGCTGGG - Intergenic
1001302909 5:170550232-170550254 GAACCAAGTGTGTTTCTGCTTGG - Intronic
1004271476 6:14199948-14199970 GATCTAGGAGTGGCTCCTCTAGG - Intergenic
1005692517 6:28321061-28321083 AATCCAGGTATGGCTCAGCAGGG - Intergenic
1006514060 6:34536337-34536359 CAGCCAGGTGGGGTTCTGCTGGG + Intergenic
1006577880 6:35059333-35059355 GGCTCAGGTGTGGCTCTGCTGGG - Intronic
1006706338 6:36024488-36024510 GAGCCAGGTGAGCCGCTGCTGGG - Exonic
1007874485 6:45080416-45080438 GATCCAGATATACCTCTGCTAGG + Intronic
1007960876 6:45957874-45957896 GAACCAGGTGGGGCTCAGTTGGG + Intronic
1007984653 6:46196140-46196162 GTTCCAGGTGTGGCTATGTCAGG + Intergenic
1010263484 6:73842592-73842614 GATCCAGCAATGGCACTGCTGGG - Intergenic
1012492625 6:99799364-99799386 GATCTAGGTTTGGCTTGGCTGGG + Intergenic
1013965300 6:115948398-115948420 AATCCAGGTGTAGCTTAGCTGGG - Intronic
1015438333 6:133216985-133217007 TACCTAGGTGTGGCACTGCTGGG + Intergenic
1017440987 6:154464189-154464211 GATCCTGGGTTGGCTCAGCTGGG + Intronic
1017772164 6:157651900-157651922 GGTCCAGGTGTGGATCTCATGGG - Intronic
1018045400 6:159961586-159961608 TATCCAGGTGTGGCTATCTTTGG - Intergenic
1021114021 7:16728671-16728693 GTTCCAGGTGTGGCTGTTTTGGG - Intergenic
1022320654 7:29284725-29284747 AGTCCAGGTGTGGCTTGGCTGGG - Intronic
1024885174 7:54133189-54133211 GACCCAGCTGTGTCACTGCTGGG - Intergenic
1024956552 7:54926944-54926966 GATCCATGTGGGGTTCTGCCAGG - Intergenic
1026139992 7:67697680-67697702 GCTCCAGGAGTGGCTCTTATTGG + Intergenic
1026608448 7:71836150-71836172 GATCCAGGCTGGGCTCAGCTGGG - Intronic
1028169362 7:87577423-87577445 GATCCAGTTATCCCTCTGCTGGG - Intronic
1028196588 7:87914334-87914356 TATGCAGTTGTGGCTCTCCTCGG - Intergenic
1029483657 7:100827003-100827025 GCTCCGGGTGCTGCTCTGCTGGG - Exonic
1031980081 7:128119113-128119135 GAGCCTGGCTTGGCTCTGCTGGG - Intergenic
1033000688 7:137501384-137501406 GATCCAGGAGTCCCACTGCTGGG - Intronic
1033523117 7:142182241-142182263 GGTCCAGCACTGGCTCTGCTGGG + Intronic
1034226298 7:149486342-149486364 GATCCAGGAGCGGAACTGCTGGG - Intronic
1034571037 7:151956544-151956566 CATTCAGCTGTGACTCTGCTTGG + Exonic
1035482553 7:159198880-159198902 GACCCAGGCGAGGCTCTGCCTGG - Intergenic
1036251277 8:7164909-7164931 AATCCAGGTGTGACTCAGCTGGG - Intergenic
1036366210 8:8122551-8122573 AATCCAGGTGTGACTCAGCTGGG + Intergenic
1036647929 8:10623659-10623681 GCTACAGATGTGGCTTTGCTGGG - Intronic
1036884687 8:12543108-12543130 AATCCAGGCGTGACTCAGCTGGG - Intergenic
1038691495 8:29767814-29767836 GATCTAGGTGTGGCTCAGCGGGG - Intergenic
1040821478 8:51563258-51563280 GATCAAGGTCTGGCACTGTTTGG + Intronic
1042566795 8:70119573-70119595 GATCCAGGAGTCACACTGCTGGG - Intronic
1047081236 8:121463302-121463324 GATCTAGGAGTCTCTCTGCTGGG + Intergenic
1047891290 8:129313993-129314015 AATCTGGGTGTGGCTTTGCTGGG - Intergenic
1049175293 8:141189009-141189031 GAACCAGGTGTGGGTTGGCTCGG + Exonic
1050127080 9:2368205-2368227 GATGCTGGTGTGTCACTGCTTGG - Intergenic
1050230931 9:3525636-3525658 GAGCCGAGTGTGGCTGTGCTGGG - Intronic
1050858264 9:10390340-10390362 AATCCAAGTGAGGCTCAGCTTGG + Intronic
1051336557 9:16070981-16071003 GTTCCAGCTTTGGCTCTGATTGG - Intergenic
1051844133 9:21432677-21432699 GACCCAGGAGTTGCTCTTCTTGG + Intronic
1056846818 9:90045581-90045603 AATCCAGGTGTGGCTTCACTGGG + Intergenic
1058763428 9:108159003-108159025 GATCCAGGTGTGCTTCCACTGGG - Intergenic
1059340771 9:113596498-113596520 CACCCAGGTGTGGCACTGCTAGG + Intronic
1060238290 9:121882061-121882083 GTTCCAGGTATGGCTCTGAATGG - Intronic
1060418332 9:123449077-123449099 GATCCAATTCTGGCTCTGCTAGG + Intronic
1060423099 9:123483437-123483459 GACCCAGGCTTTGCTCTGCTTGG - Intronic
1060531712 9:124350913-124350935 CATCCAGATGTGCATCTGCTTGG - Exonic
1061181283 9:129026620-129026642 GGCCTAGGTGTGGCTCCGCTTGG - Intronic
1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG + Intronic
1062002793 9:134225267-134225289 TATGCAGGTGTGGTTCTGCAGGG - Intergenic
1062150401 9:135015426-135015448 GATGCAGGAGTGGAACTGCTGGG - Intergenic
1203753433 Un_GL000218v1:101119-101141 GATCCAGGTTTTTCTTTGCTAGG - Intergenic
1185576813 X:1181028-1181050 TATCCAGGTGTGGCCCGGCAGGG + Intergenic
1186904686 X:14098662-14098684 AATCCAGTTGTGGCTTAGCTGGG + Intergenic
1187572177 X:20515917-20515939 GATCTAGGCTGGGCTCTGCTGGG + Intergenic
1188615737 X:32156918-32156940 CTTCCAGGTGTGGATCTGTTGGG - Intronic
1188933363 X:36142943-36142965 GAAGAATGTGTGGCTCTGCTGGG - Intronic
1190242863 X:48671368-48671390 TATCCAGGTGTGGCTGGGCGTGG - Intergenic
1192178641 X:68901669-68901691 GCACCAGGCCTGGCTCTGCTTGG - Intergenic
1193816472 X:86110222-86110244 GATCCAGCTATTTCTCTGCTGGG + Intergenic
1196156683 X:112438123-112438145 GATTCAGGAGTGGCTTAGCTGGG + Intergenic
1198502098 X:137260392-137260414 GATCCAGGAGTGGCTTAGGTAGG + Intergenic
1198521141 X:137453852-137453874 GATCTAAGCGGGGCTCTGCTGGG - Intergenic
1200328760 X:155271878-155271900 GATCCAGCAGTGTCACTGCTGGG - Intergenic
1200923777 Y:8636272-8636294 GTGGCCGGTGTGGCTCTGCTTGG + Intergenic
1200927439 Y:8667206-8667228 TGTCCATGTGTGGCTCTGCTTGG + Intergenic
1201147683 Y:11073802-11073824 GATCAAGGTGTGGCAGGGCTGGG - Intergenic