ID: 1061801303

View in Genome Browser
Species Human (GRCh38)
Location 9:133114746-133114768
Sequence CGTGCTTGGCTGTGTCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061801299_1061801303 16 Left 1061801299 9:133114707-133114729 CCGCTATGAGCTGACTGCTAGGA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG No data
1061801296_1061801303 25 Left 1061801296 9:133114698-133114720 CCCAGGCAGCCGCTATGAGCTGA 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG No data
1061801297_1061801303 24 Left 1061801297 9:133114699-133114721 CCAGGCAGCCGCTATGAGCTGAC 0: 1
1: 0
2: 4
3: 10
4: 90
Right 1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061801303 Original CRISPR CGTGCTTGGCTGTGTCCTCA AGG Intronic
No off target data available for this crispr