ID: 1061801856

View in Genome Browser
Species Human (GRCh38)
Location 9:133117084-133117106
Sequence GGCTCCTCGGGTGCGTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061801856_1061801867 11 Left 1061801856 9:133117084-133117106 CCAGGTGACGCACCCGAGGAGCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1061801867 9:133117118-133117140 GAAGGGTCAGGCCGCTCCCCTGG No data
1061801856_1061801863 -6 Left 1061801856 9:133117084-133117106 CCAGGTGACGCACCCGAGGAGCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1061801863 9:133117101-133117123 GGAGCCCAGGGCACTTGGAAGGG No data
1061801856_1061801862 -7 Left 1061801856 9:133117084-133117106 CCAGGTGACGCACCCGAGGAGCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1061801862 9:133117100-133117122 AGGAGCCCAGGGCACTTGGAAGG No data
1061801856_1061801866 -1 Left 1061801856 9:133117084-133117106 CCAGGTGACGCACCCGAGGAGCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1061801866 9:133117106-133117128 CCAGGGCACTTGGAAGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061801856 Original CRISPR GGCTCCTCGGGTGCGTCACC TGG (reversed) Intronic
900162974 1:1233103-1233125 GGCTCTGCTTGTGCGTCACCAGG - Exonic
900748475 1:4377644-4377666 GTCTGCTCGGCTGCGTCTCCAGG - Intergenic
900990958 1:6098099-6098121 CGGTCCCCGGGTGTGTCACCCGG + Intronic
904171325 1:28593684-28593706 GCCTCCCCAGGTGCATCACCAGG + Exonic
905308378 1:37034034-37034056 GGCTCCTCGTGTGCGCCTTCTGG - Exonic
907323160 1:53618383-53618405 GGCCCCTAGGGTGGGTCACCAGG + Intronic
909666625 1:78141655-78141677 GGCTCCTCAGGTGTCTGACCTGG + Intergenic
910170054 1:84367978-84368000 GGCTCCTCGGGTCAGAAACCTGG + Intronic
912437010 1:109668848-109668870 GGCTCCTTGGGAGGGTCCCCAGG + Intronic
912443019 1:109713045-109713067 GGCTCCTTGGGAGGGTCCCCGGG + Intronic
916647101 1:166797131-166797153 GGATCCTCGGGGGCCTCCCCTGG - Intergenic
921499871 1:215888614-215888636 GACTCCTCGGGAGAGTCACCAGG + Exonic
922810737 1:228414293-228414315 GGCTCCTTGGGAGCGACTCCTGG + Intronic
1073011691 10:100365082-100365104 GGGTTCTCGGGTGTGTCACGTGG + Intergenic
1074185847 10:111098873-111098895 GGGTCCTTGGCTGAGTCACCTGG - Intergenic
1088883088 11:113986925-113986947 GCCTGCTTGGCTGCGTCACCTGG + Exonic
1091911038 12:4230884-4230906 TCCTCCTCTGGTGCCTCACCCGG + Intergenic
1101132496 12:101703646-101703668 GGCTCCTCTGGAGCCTCCCCAGG + Intronic
1104894345 12:132154447-132154469 CGCTCCTCGGGGGCAGCACCTGG - Intergenic
1122802553 14:104238943-104238965 GGCTCCTCCGGTGCATGGCCAGG - Intergenic
1124963070 15:34412481-34412503 AGCTGCTCGGGTGCGACATCAGG + Intronic
1124979693 15:34558707-34558729 AGCTGCTCGGGTGCGACATCAGG + Intronic
1126920350 15:53514853-53514875 GGCTCCTCGGCAGCGTGTCCAGG - Exonic
1140412186 16:74747950-74747972 GGCTCCTCGGATGCCTCCCTCGG - Intronic
1141474527 16:84263801-84263823 GGCTCCTCAGGTGTGTCTCAGGG - Intergenic
1144758227 17:17693160-17693182 GGCTGCACGGGGGCGTCACATGG - Intronic
1148113753 17:45162510-45162532 TGCTCCTCGGGTCCCTCACCAGG - Exonic
1152132618 17:78486205-78486227 GGCCCCCCAGGTGCATCACCTGG + Exonic
1152713763 17:81888334-81888356 GCCTCCGCGGGTGCCTCTCCGGG + Exonic
1153226773 18:2906215-2906237 AGCTCCTGGCGTGCGTCTCCCGG - Intronic
1160630992 18:80246653-80246675 GCCTCCCCGGGCGCGTCCCCGGG - Intronic
1165058563 19:33194250-33194272 GGCTCGGCGGGCGCGTCACGTGG + Intronic
1168011491 19:53537384-53537406 AGCCCCTCTGGAGCGTCACCTGG - Intronic
1168062136 19:53898878-53898900 GGCTCCTCGGGGGCGTGGCCAGG + Intronic
1168062201 19:53899132-53899154 AGCTCCTCGGGGGCGTGGCCAGG + Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
931213545 2:60220578-60220600 GGCTCCATGGGGGCTTCACCTGG - Intergenic
937082441 2:119150005-119150027 GGCTCCTCAGCTGTGTCCCCAGG - Intergenic
947200871 2:227613471-227613493 AGCTCCTTGGGTGTGTCTCCCGG - Intronic
948797764 2:240413395-240413417 GGCTCCTCGGCTCCCTCACACGG + Intergenic
1170136078 20:13074934-13074956 GGCTGCTCGTCTGCTTCACCTGG - Intronic
1170986776 20:21266222-21266244 GGCTCCTCTGGTGCATCAGGAGG - Intergenic
1175924643 20:62465821-62465843 GGCTCCTCAGGTGCGTGGCCAGG - Exonic
1177763085 21:25424871-25424893 ACCTCCTAGGGTGCGTCCCCAGG - Intergenic
1184969628 22:48006554-48006576 GGCTCCTCTGGTCTGTGACCGGG + Intergenic
1185098091 22:48822463-48822485 GGGTCCTCTGGTGAGTCACGTGG - Intronic
953564774 3:44022075-44022097 CGCTCCTCGGGGTGGTCACCGGG + Intergenic
967315255 3:188146567-188146589 GGGTCCTCGGTTGTGTCTCCAGG + Intergenic
968520402 4:1032432-1032454 GGCTCCTGGGGTGTGTCCTCTGG + Intergenic
969526741 4:7707681-7707703 GGCTTCACTGGTGCGTCCCCAGG + Intronic
980134894 4:128849372-128849394 GGCTCCTCGGCTCAGGCACCAGG + Intronic
985860567 5:2467377-2467399 GGGACCTGGGGTGCTTCACCTGG - Intergenic
985866191 5:2516311-2516333 CGCTCCCTGGGTGCGTCACTGGG - Intergenic
998444383 5:142187273-142187295 GGCTCCTCTGGTGCCTCCTCTGG + Intergenic
998994889 5:147860754-147860776 GTCTCCTCAGGTACCTCACCTGG - Intergenic
1001198893 5:169698186-169698208 GGTTCCTCGCGTGCAGCACCAGG - Intronic
1006447410 6:34087562-34087584 GGCTCCTCTGCAGCATCACCAGG - Intronic
1019158851 6:170056434-170056456 GGCTCTGCGGGGCCGTCACCGGG - Intergenic
1019348930 7:544138-544160 GGGCCCTCGGGTGGGTCCCCAGG - Intergenic
1020131988 7:5563748-5563770 GGCGCGTCGGTTGCGCCACCTGG - Intronic
1021206544 7:17787457-17787479 GGCTCAGCAGGTGAGTCACCTGG + Intergenic
1023092173 7:36627614-36627636 GGCTCCTCGGGAGGGGCAGCAGG + Intronic
1024673546 7:51617906-51617928 GGCCCCTCAGCTGAGTCACCAGG + Intergenic
1026807348 7:73436537-73436559 GGCTCCTCGGGGCCCCCACCAGG + Intergenic
1026853148 7:73737202-73737224 GGCACCTTGGGTGTATCACCTGG + Exonic
1027166201 7:75836013-75836035 GCCTCCCCGGGTGCCTCCCCGGG - Intergenic
1027166205 7:75836025-75836047 GCCTCCACGGGTGCCTCCCCGGG - Intergenic
1033657062 7:143381539-143381561 GGCTGCTGGGGTGGGTCGCCGGG - Exonic
1056743452 9:89280000-89280022 GGCTCCTGGTGTGAGTCACGGGG + Intergenic
1057054577 9:91950426-91950448 GGCGCCTTGGGGGCGTCAGCCGG + Intergenic
1061801856 9:133117084-133117106 GGCTCCTCGGGTGCGTCACCTGG - Intronic
1185890134 X:3815739-3815761 GGCTCCGCGGCTGCGTTTCCCGG - Intergenic
1192737293 X:73861597-73861619 GGCTCCTGGGTTGTGTCACCAGG + Intergenic