ID: 1061805082

View in Genome Browser
Species Human (GRCh38)
Location 9:133133333-133133355
Sequence GGGACTCCTGCATTTCTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061805082_1061805088 -3 Left 1061805082 9:133133333-133133355 CCACGCAGAAATGCAGGAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1061805088 9:133133353-133133375 CCCGAGGAGGTGGTGCTGGCAGG No data
1061805082_1061805092 2 Left 1061805082 9:133133333-133133355 CCACGCAGAAATGCAGGAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1061805092 9:133133358-133133380 GGAGGTGGTGCTGGCAGGAGGGG No data
1061805082_1061805093 11 Left 1061805082 9:133133333-133133355 CCACGCAGAAATGCAGGAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1061805093 9:133133367-133133389 GCTGGCAGGAGGGGAGCAGCAGG No data
1061805082_1061805091 1 Left 1061805082 9:133133333-133133355 CCACGCAGAAATGCAGGAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1061805091 9:133133357-133133379 AGGAGGTGGTGCTGGCAGGAGGG No data
1061805082_1061805094 12 Left 1061805082 9:133133333-133133355 CCACGCAGAAATGCAGGAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1061805094 9:133133368-133133390 CTGGCAGGAGGGGAGCAGCAGGG No data
1061805082_1061805086 -7 Left 1061805082 9:133133333-133133355 CCACGCAGAAATGCAGGAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1061805086 9:133133349-133133371 GAGTCCCGAGGAGGTGGTGCTGG No data
1061805082_1061805090 0 Left 1061805082 9:133133333-133133355 CCACGCAGAAATGCAGGAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1061805090 9:133133356-133133378 GAGGAGGTGGTGCTGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061805082 Original CRISPR GGGACTCCTGCATTTCTGCG TGG (reversed) Intronic
902800843 1:18829061-18829083 GCGACTCCTGAATGTCTGCTTGG + Intergenic
903648539 1:24909507-24909529 GGAACTCCGTCATTTCTGTGGGG - Intronic
903997166 1:27314506-27314528 GGGACTTCTGCATTTGTGGAGGG + Intergenic
907274749 1:53310987-53311009 GGGCCTCCTGCATTTCCTCCGGG - Intronic
911270693 1:95797699-95797721 GGGACTGCTGCCTTTCTTTGAGG - Intergenic
914428286 1:147599190-147599212 GGGACTCCTGCACTTCGCAGAGG + Intronic
915237087 1:154491874-154491896 GGGACTCCTTCAGTTATGGGTGG + Intronic
924299967 1:242627148-242627170 GGTACTTCTGAATTTCTGAGGGG + Intergenic
924582726 1:245335826-245335848 GGGACTCCTCCTTCTCCGCGTGG - Intronic
1067497860 10:46775219-46775241 GAGGCTCCTGCATTCCTGAGGGG + Intergenic
1067596790 10:47565195-47565217 GAGGCTCCTGCATTCCTGAGGGG - Intergenic
1069052679 10:63811617-63811639 GGGACTCCTCGCTTTCAGCGGGG + Intergenic
1069071695 10:63996166-63996188 GGGAGCCCTGCATTTCTTTGGGG + Intergenic
1069234742 10:66056768-66056790 GGAACTCCTCCATTTCTTCTAGG + Intronic
1069910789 10:71757910-71757932 GGAGCTCCTGCATTGCTGAGGGG - Intronic
1071022835 10:81079286-81079308 GGGATTTTTGCATTTCTGTGGGG + Intergenic
1074830844 10:117247590-117247612 GGGTCTCCAGCAGTTCTGCCTGG - Intronic
1076449539 10:130547158-130547180 GGATCTCCTGCAGTTGTGCGGGG + Intergenic
1081014023 11:37853628-37853650 GAGACTCCTGCAATGCTGCGTGG - Intergenic
1081659791 11:44880984-44881006 GGGACTCCTGCTGTCCTGCCTGG + Intronic
1085816442 11:79742197-79742219 GGTACTCCTTCATTACTGGGGGG - Intergenic
1088305774 11:108405918-108405940 GGGACTTCTGCATTCCTGAAGGG - Intronic
1088794318 11:113254830-113254852 GGGAATCCTGCACTTCTGTGAGG - Intronic
1090242985 11:125197118-125197140 GGGACCCCTGCTTCTCTGAGGGG + Intronic
1090433870 11:126669657-126669679 AGGACTCCTGCACTTCCTCGTGG + Intronic
1090943480 11:131409409-131409431 GGGACTCCTGCACCTCTCTGTGG - Intronic
1091489832 12:923514-923536 GGCACTCCTGCATTCCAGCCTGG + Intronic
1093169407 12:15842773-15842795 GGTACTACTGCATTCCTGCCTGG + Intronic
1096185653 12:49578896-49578918 GGCTCTCCTGCCTTTGTGCGTGG - Intronic
1097976497 12:65692200-65692222 GGCACTCCTGCATTTTAGCCTGG - Intergenic
1104231982 12:126894081-126894103 TGGATTCCTGCATGACTGCGTGG + Intergenic
1105322936 13:19345424-19345446 GGGAGTTCTGCCTTCCTGCGTGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1120599918 14:86490425-86490447 GGGGCTCCTTCAGTTCTGGGTGG + Intergenic
1129185607 15:73904316-73904338 GGGCTTCCTGCATGCCTGCGGGG - Intergenic
1129455292 15:75673475-75673497 GGGAGTCCTGCTTTTCAGTGTGG + Intergenic
1132890166 16:2199833-2199855 GTAGCTCCTGCATTTCTGTGGGG - Intergenic
1132995082 16:2818532-2818554 TGGGCTCCTTCATTTCTGCAGGG + Intronic
1134120552 16:11581142-11581164 GGGACTCCCACATTTATGCATGG + Intronic
1135394239 16:22118931-22118953 GGGCCTTCTGAATTTCTGCCAGG - Exonic
1138098514 16:54232657-54232679 GGGAGGCCTGCCTTTCTGCTGGG - Intergenic
1138583785 16:57957811-57957833 GGGACAACTGCAGTTCTGAGAGG + Intronic
1139908468 16:70381958-70381980 GGGGCTCCTGCATCTCCCCGGGG - Intronic
1142990056 17:3724300-3724322 GGGTGTGCTGCACTTCTGCGGGG - Exonic
1143333628 17:6156728-6156750 GTGACTCCTGCACTCCTGAGTGG - Intergenic
1145125543 17:20297107-20297129 AGGACTCCTGCATTTCTTAGAGG - Intronic
1145810273 17:27760169-27760191 GGGACTCCTGCAGGAGTGCGGGG - Exonic
1146063328 17:29618234-29618256 GGGCCGCGTGCATGTCTGCGTGG - Intronic
1147305931 17:39564389-39564411 GGCACTCCTCCATTCCTGCCAGG - Intronic
1152376246 17:79920265-79920287 GGGTCTCCTGCCTTCCTGGGTGG - Intergenic
1152376421 17:79921042-79921064 GGGTCTCCTGCCTTCCTGGGTGG + Intergenic
1159754519 18:72348052-72348074 GGCACTCCTGTGTTTCTGCCCGG - Intergenic
1161115395 19:2494072-2494094 GGGAGCCCTGGGTTTCTGCGTGG - Intergenic
1163202320 19:15778007-15778029 GGGGCTCCTGCAGTACTGTGGGG - Intergenic
1165360844 19:35336064-35336086 GGGACTCTTGAATTTCTGGAGGG - Exonic
1167249571 19:48392937-48392959 TGGACTCCTGCATCTATGAGGGG + Intergenic
1167539345 19:50075303-50075325 GGGACTCCTGGGTCTCTGGGTGG + Intergenic
1167630365 19:50622555-50622577 GGGACTCCTGGATCTCTGGGTGG - Intronic
1168197319 19:54784674-54784696 GTCACTCCTCCATATCTGCGGGG + Intronic
926679052 2:15650173-15650195 GGGACTCCTGTCTTTCTCCATGG + Intergenic
929908601 2:46068938-46068960 GGAAATCCTGCATTTCTAAGAGG - Intronic
933216419 2:79635460-79635482 GTGACTACTGCATTTCTGACAGG + Intronic
938962451 2:136355427-136355449 GGGGCTCCTGCAGTGCTGAGAGG + Intergenic
940945819 2:159616113-159616135 GGGACTCCGGAGTTGCTGCGTGG - Intronic
942398376 2:175576136-175576158 GCAACTCCTGCATATCTGCTTGG + Intergenic
943764138 2:191642191-191642213 TGCACTCCTGAATTTCTGAGTGG + Intergenic
1174822476 20:53738728-53738750 GAGACTCCTGCCTTTCGGGGCGG + Intergenic
1176159330 20:63640589-63640611 GGAACTCTTGCACTTCTGAGTGG + Exonic
1179712746 21:43272672-43272694 GGGACTCCCCCATTTCCGGGGGG - Intergenic
1179948857 21:44698429-44698451 GGGACTGGTACATTCCTGCGGGG - Intronic
1181778841 22:25178561-25178583 GGAACTCTTGCACTTCTGAGTGG + Intronic
1182230852 22:28836513-28836535 GGGACTCCTGCACTCCAGCCTGG + Intergenic
1185216007 22:49600318-49600340 GGCATTCCTGCATTGGTGCGTGG - Intronic
950258699 3:11527929-11527951 CCCACTCCTGCATTTCTGCATGG - Intronic
954147334 3:48640874-48640896 GGGGTTCCTGCATTTCAGCCAGG - Intronic
955262084 3:57401890-57401912 GGGACTTATCCATTTCTGCTAGG - Intronic
957508292 3:81154842-81154864 GGGACTCCTGCAGTTCTCACAGG + Intergenic
959956867 3:112249750-112249772 GGGATTCTTGTATTTCTGTGGGG + Intronic
966808850 3:183825973-183825995 GCGACTGCTGCATTTGTGCCAGG + Intergenic
970525678 4:16929468-16929490 AGGACCTCTGCATTTCTGCCTGG - Intergenic
975459401 4:74632886-74632908 ATGACTCCTGCATTTCTCAGAGG + Intergenic
977099327 4:92789992-92790014 GGGACTCCTCAATTTCTGGTGGG + Intronic
982164855 4:152605161-152605183 GGGAAGCCTGCATTCCTGAGGGG + Intergenic
983094430 4:163544634-163544656 GTTACTTCTGCATTTCTGCGTGG - Intronic
985985857 5:3515709-3515731 GGGCCTCCTGCATTTGGGCAGGG - Intergenic
988531320 5:32029792-32029814 GGGTCTCTTGCATTTCTGCATGG - Intronic
988979571 5:36553177-36553199 GGGGCTCCTGCATTCCTTCTTGG - Intergenic
993337241 5:86675620-86675642 GGGACACCTGCTTTTCAGCCGGG + Intergenic
996852919 5:127972825-127972847 GGCACCACTGCATTCCTGCGTGG - Intergenic
999243563 5:150140989-150141011 GGGGGCCCTGCATTGCTGCGGGG + Intronic
1001013255 5:168117664-168117686 GGGACTACTTCATTTCTTCATGG + Intronic
1001920986 5:175599550-175599572 GGTACTCCAGCACTGCTGCGTGG - Intergenic
1004530515 6:16450837-16450859 TGGACACCTGTATTTCTGAGAGG - Intronic
1006410857 6:33872515-33872537 GGGACCCCTGCACCTCTGCTGGG - Intergenic
1015183529 6:130386893-130386915 GGCACTCCTGCATTACTCCCAGG + Intronic
1016682836 6:146850696-146850718 GGGACCCCTGCATTACTGTGTGG + Intergenic
1020057034 7:5124846-5124868 GGAACTGCTGAATTTCTGAGAGG + Intergenic
1020883338 7:13791938-13791960 TGGACTCCTGCATTTCCCCATGG - Intergenic
1021687938 7:23205923-23205945 GTGACTCCTGCATTCCGGCCCGG + Intergenic
1025810436 7:64872122-64872144 GGGACCCCTGCCTCTCTGCACGG - Intronic
1025812573 7:64884561-64884583 GGGAGTCCTGCTTCTCAGCGCGG - Intronic
1026985121 7:74550150-74550172 CGCACTCCTGCATTTCAGCCTGG + Intronic
1034673701 7:152876528-152876550 GGGGTTTCTGCATTTCTGGGTGG - Intergenic
1035102171 7:156409265-156409287 GGCACTACTGCATTTCTGCCTGG - Intergenic
1035948538 8:3992837-3992859 GGCACTGCAGCATTGCTGCGTGG + Intronic
1036583699 8:10102767-10102789 GGCACTCCCTCATTTCTGTGAGG + Intronic
1048437594 8:134432539-134432561 AGGATTCTTGCATTTCTGGGTGG - Intergenic
1049710782 8:144062427-144062449 GGGGCTCCTGCATGTGGGCGTGG - Intronic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1057400429 9:94718628-94718650 GGGACTTCAGGATTTCTGGGTGG - Intergenic
1057497671 9:95573680-95573702 TGAACTCCTGCATTGCTGCCTGG + Intergenic
1059259955 9:112966111-112966133 GTGACTCCTTCCTTTCTGCCAGG + Intergenic
1059792584 9:117656506-117656528 GGGACTCCTGAATGACTGCAGGG - Intergenic
1060047517 9:120352278-120352300 GGCACTCCTGGATCTCTGAGAGG - Intergenic
1061700193 9:132410055-132410077 GGGGCTCCTGCATTGCTCCGGGG + Intronic
1061805082 9:133133333-133133355 GGGACTCCTGCATTTCTGCGTGG - Intronic
1186293719 X:8125902-8125924 TGGGCTCCTGCATTCCTGCAAGG + Intergenic
1187253694 X:17622484-17622506 GGGACTCCTGCTTTTGTTGGAGG - Intronic
1187812053 X:23190304-23190326 GGGGCTCCAACATTTCTGCCTGG + Intergenic
1194261259 X:91699160-91699182 AGGACTGCTGCATTTCTGCATGG + Intergenic
1194971446 X:100348506-100348528 GGGACACATGCATTTTTGCCAGG - Intronic
1198874600 X:141209602-141209624 CTGACTCCTTCATTTCTGCTTGG + Intergenic
1199253482 X:145691850-145691872 GGGATTTCTGTATTTCTGTGAGG + Intergenic
1199791658 X:151161027-151161049 GGGACAGCTGCATTTATGGGAGG - Intergenic
1200156947 X:153981892-153981914 AGGACTCCTGCCTTCCTTCGGGG + Exonic
1200579908 Y:4937961-4937983 AGGACTGCTGCATTTCTGCATGG + Intergenic